Labshake search
Citations for Millipore Sigma :
5951 - 6000 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Bioengineering 2023Quote: Liposomal NPs encapsulating MRX-2843 or venetoclax were made by first mixing organic solutions of DSPC (1,2-distearoyl-sn-glycero-3-phosphocoline; NOF Corporation, Shanghai, China), DSPG (1,2-distearoyl-sn-glycero-3-phosphoglycerol, sodium salt; NOF) and cholesterol (Sigma-Aldrich) lipids together at a 7:2:1 mol:mol ratio ...
-
bioRxiv - Plant Biology 2023Quote: The auto activity of yeast baits on Sc-His due to minimal HIS3 expression was determined by spotting them on Sc-His media containing 0-30 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma-Aldrich, USA). The minimum concentration of 3-AT that completely inhibits the growth of the bait was considered for the Y1H assay (20mM for pdistal ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Plant Biology 2023Quote: Leaf disks (3 mm) of Arabidopsis thaliana and Nicotiana benthamiana were fixed with 3% (w/v) glutaraldehyde (Sigma, Taufkirchen, Germany) in 0.1 M sodium cacodylate buffer (SCB ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Microbiology 2023Quote: ... organoids were treated four days after ex vivo Hsp60 deletion with the Ido1 agonist 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich) or the Ido1 antagonist dimethyltryptamine (1-D-MT ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Lysate samples were MWCO filtered using 3 kDa and 10 kDa Amicon filters (Merck Millipore, catalog no.: UFC500308 (3 kDa), UFC501008 (10 kDa) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cancer Biology 2024Quote: ... OVCAR-3 and SK-OV-3 cells were treated with the dicarbonyl stress-inducing compound methylglyoxal (MG) (M0252, Sigma-Aldrich) for 48-72 h.
-
bioRxiv - Plant Biology 2024Quote: ... followed by the reaction of Fe3+ with the xylenol orange dye (o-cresolsulfonephthalein 3′,3″-bis[methylimino] diacetic acid, sodium salt; Sigma). Ten seeds were placed in each well of 12-well plates containing 2 mL of liquid MS/2 medium ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... range = 1:55-2:03) after dexamethasone administration and was immediately followed by an intramuscular injection of ACTH (Sigma-Aldrich, France, 4.0 IU.kg−1). A third blood sample was collected one hour (mean±SD = 0:59±0:01 ...
-
bioRxiv - Neuroscience 2020Quote: ... The membrane was washed in TBST 2 × 15 min and incubated for 1 hour in room temperature with HRP-conjugated anti-rabbit antibody (Sigma-Aldrich, NA9043, 1:2,500) diluted in TBST with 5 % non-fat dry milk ...
-
bioRxiv - Bioengineering 2021Quote: ... Marimastat ((2S,3R)-N-[(1S)-2,2-dimethyl-1-(methylcarbamoyl)propyl]-N’,2-dihydroxy-3-(2-methylpropyl)butanediamide), ɑ2-antiplasmin (SRP6313-100) and recombinant plasminogen activator inhibitor 1 (PAI-1, 528208) were purchased from Sigma-Aldrich (Saint-Louis, MI). Sodium alginate (SA ...
-
bioRxiv - Immunology 2022Quote: ... Perturbation profiling of the use of metabolic pathways by T cells was achieved by the addition of oligomycin (O4876; 1 µM), Carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone (FCCP, C2920; 2 µM) and rotenone (R8875; 1 µM - all from Sigma Aldrich, St. Louis, MO). Metabolic parameters were then calculated based on the following formulas:
-
bioRxiv - Microbiology 2020Quote: ... rabbit polycolonal anti-SARS-CoV-2 S2 antibodies (1:1000) (Sinobiological Inc, Beijing, China) and anti-FLAG M2 antibody (1:1000) (Sigma, St. Louis, MO, USA), respectively.
-
bioRxiv - Biochemistry 2023Quote: ... The blots were probed with the following primary antibodies at room temperature for 1-2 hours or at 4 ℃ overnight: anti-GAPDH (Millipore, #MAB374, 1:5,000 dilution), anti-Flag M2 (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were incubated with primary antibody to stain tubulin (mouse anti-α-tubulin B-5-1-2 mAb, Sigma-Aldrich, T5168, dilution 1:250) for 4 h at room temperature ...
-
bioRxiv - Zoology 2023Quote: ... All wells were then washed with embryo media three times before being incubated on an orbital incubator shaker at 130 rpm and 28°C for 15-20 minutes in media containing 0.01% 2-[4-(dimethylamino) styryl]-1-ethylpyridinium iodide (DASPEI, Sigma Aldrich; cat. #3785-01-1) to selectively stain live neuromast hair cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Filters were washed three times with TTBS buffer and then incubated for 1 hour with secondary peroxidase-coupled anti-rabbit antibody (1:7000, Millipore, Cat #401393-2 ML). Immunostaining was revealed by enhanced chemiluminescence luminosity (Amersham Pharmacia Biotech ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: Mice aged 6 months or naked mole-rats aged 2-4 years were intraperitoneally (i.p.) injected with 1mg (2′S)-2′-Deoxy-2′-fluoro-5-ethynyluridine (F-ara-EdU; Sigma) from a 10mg/ml stock in DMSO diluted with sterile 0.9% sodium chloride solution (Sigma).
-
bioRxiv - Plant Biology 2021Quote: ... 20 μl 40 mM glucose-6-phosphate (Sigma-Aldrich, now Merck KGaA) and 20 μl 35 mM NADP+ (KMF OptiChem ...
-
bioRxiv - Immunology 2021Quote: ... Dried lipids were then combined with 5(6)-carboxyfluorescein (CF) (Sigma #21877) and vortexed for 5 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 250 μl of washing buffer supplemented with 6 mM free biotin (Sigma) was added to the beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5min room temperature incubation in 0.1N NaOH (Sigma-Aldrich, Inc., SX0607N-6), another TE-TW wash ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were cultured in 6-well plates and 20µM siRNA oligonucleotides (Sigma, SASI_Hs01_0086240 for AKTIP ...
-
bioRxiv - Genomics 2021Quote: ... complexed with 6 mg pre-swollen protein A Sepharose beads (Sigma-Aldrich) during a 2-h incubation at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: 8-(tri-fluoromethyl)-1,2,3,4,5-benzopentathiepin-6-amine hydrochloride (TC-2153 (Sigma-Aldrich)) or vehicle (5% DMSO in saline ...
-
bioRxiv - Bioengineering 2020Quote: ... 0.84 v% chondroitin-6-sulfate sodium salt from shark cartilage (Sigma Aldrich), and additional calcium nitrate tetrahydrate (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: Adult zebrafish (6 months old) were anaesthetized in 0.016% tricaine (Sigma, MS222), and a spinal cord crush injury was performed according to a previously described method (Fang et al. ...
-
bioRxiv - Microbiology 2021Quote: The washed beads were resuspended in 500 μL 6 M urea (Sigma) in PBS and incubated with 10 mM DTT (GoldBio ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM potassium ferrocyanide [K4Fe(CN)6·3H20] (Sigma cat. # P-9287), 5 mM potassium ferricyanide [K3Fe(CN)6] (Sigma cat ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and incubated with 7 mL of 6 ppm CdCl2 (Sigma Aldrich 202908) in ddH2O for 90 min on an orbital shaker ...
-
bioRxiv - Bioengineering 2022Quote: ... lipids were removed from paraformaldehyde fixed tissues using 6% SDS (Sigma L3771) in PBS over a period of days to weeks ...
-
bioRxiv - Cancer Biology 2022Quote: ... CDK4/6 inhibitor Palbociclib (PD 0332991 isethionate) was purchased from Sigma-Aldrich. CDK4/6 Inhibitor IV (CAS 359886-84-3 ...
-
bioRxiv - Immunology 2021Quote: ... mature macrophages (n=6 individual donors) were detached using Accutase (Merck Millipore), blocked with 10% pooled human serum in PBS for 30 minutes and incubated with various concentrations of rRABV-tG (0-100 μg/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... RGCs were plated on 6-well plates coated with PDL (Sigma # P6407) and laminin (Cultrex Trevigen #3400-010-01 ...
-
bioRxiv - Biochemistry 2020Quote: ... ZINC57310 (2b) and ZINC988970/rosmarinic acid (6) were purchased from Sigma-Aldrich.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µL of 6 µM RNP supplemented with Fast Green FCF (Sigma) to facilitate visualization of RNP complexes delivery were injected to each uterine horn using a Hamilton Neuros syringe (Hamilton ...
-
bioRxiv - Molecular Biology 2020Quote: ... RAD52 was inhibited using 6-hydroxy-DL-dopa (L-DOPA, Sigma Aldrich) [51].
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... all rats received unilateral injections of 8 mg 6-OHDA (Sigma-Aldrich) in 4 mL of saline with 0.1% ascorbic acid into the right medial forebrain bundle (AP −2.2 mm ...
-
bioRxiv - Molecular Biology 2020Quote: ... coupled with 6 μl of the FLAG M2 antibody (Sigma-Aldrich, #F3165) were used ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guts were stained in a 6:4 dilution of OilRedO (Sigma-Aldrich, 0.1% stock solution diluted in isopropanol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... at 20,000 rpm through a 6% iodixanol gradient (Sigma Aldrich, D1556-250mL) for 1.5-2 hours at 4°C.
-
bioRxiv - Immunology 2021Quote: ... Antigen retrieval protocol were achieved using Citrate buffer pH 6 (Sigma-Aldrich). Sections were saturated during 30 minutes in PBS 10% Human Serum 0,3% Saponin and incubated at 4°C with primary antibody overnight in PBS 10% Human Serum 0,3% Saponin ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-9 COCS were plated per PTFE-coated cell culture insert (Millipore) in organotypic slice culture medium [134] ...
-
Using optogenetics to link myosin patterns to contractile cell behaviors during convergent extensionbioRxiv - Developmental Biology 2021Quote: ... Embryos in early stage 6 were selected under halocarbon oil 27 (Sigma), dechorionated with 50% bleach for 2 min ...
-
bioRxiv - Cell Biology 2020Quote: ... for 6 min at −20°C or 100% cold Methanol (#32213, Sigma) for 6 min at −20° or with 0,25% Triton for 15 min at RT ...
-
bioRxiv - Cell Biology 2020Quote: MC3T3-E1 cells (mouse C57BL/6 calvarial fibroblasts; cat# 99072810, Sigma-Aldrich)
-
bioRxiv - Immunology 2020Quote: ... The cells were pretreated with dexamethasone (10−6 M, Sigma, MO, USA) for 3hrs before stimulating with vehicle (ethanol ...