Labshake search
Citations for Millipore Sigma :
5651 - 5700 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: Mice were anesthetized using Avertin (2, 2, 2-tribromoethanol; Sigma-Aldrich, 476 mg/kg, i.p) and placed into a stereotactic frame (Kopf) ...
-
bioRxiv - Neuroscience 2021Quote: Mice were anaesthetized using Avertin (2, 2, 2-tribromoethanol; Sigma-Aldrich, 476 mg/kg, i.p.) and were surgically implanted with a microdrive (manufactured with the assistance of the Advanced Manufacturing Support Team ...
-
bioRxiv - Neuroscience 2020Quote: Mice were anaesthetized using Avertin (2, 2, 2-tribromoethanol; Sigma-Aldrich, 476 mg/kg, i.p.) and were surgically implanted with a microdrive (manufactured with the assistance of the Advanced Manufacturing Support Team ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2% glucose) or YPL (0.5% yeast extract, 2% peptone and 2% lactate (Sigma L1375)) ...
-
bioRxiv - Cell Biology 2020Quote: ... 40 mL of 3% polyvinyl alcohol (3% w/v PVA) (Sigma-Aldrich CO., St. Louis, MO, USA) were added and the mixture was mechanically stirred at 600 rpm for 4 h (RW-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were placed into a diaminobenzidine (DAB) solution in dH20 (Sigma-Aldrich Fast 3–3’ Diaminobenzidine Tablets) for 2 minutes and then rinsed thoroughly with TBS to prevent further DAB reactions ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrated to ∼3 mg/mL using Amicon Ultra centrifugal filter (3 kDa molecular weight cut-off) (Millipore) and loaded onto the size-exclusion Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Systems Biology 2022Quote: ... 3 ml of supernatant were homogenized with 3 ml of ethyl acetate (Millipore Sigma, item number 270989). Organic and aqueous layers were separated by centrifugation at 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μl of 3 μM TO-PRO-3 or 50 μl 10 μg/mL DAPI (Sigma D9542) in PBS was added ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg of protein from each sample were incubated with 3 ug of HOXA9 (Millipore # 07-178) or Rabbit IgG Isotype control (Invitrogen # 02-6102 ...
-
bioRxiv - Neuroscience 2022Quote: ... after which the slices were washed with the blocking solution 3 times and stained with the nuclear marker DAPI (Sigma–Aldrich, 1 mg/ml 1:1000) for 15 min at RT ...
-
bioRxiv - Neuroscience 2021Quote: ... This was followed by 1-hour incubation at RT with the diluted secondary antibody after which the slices were washed with the blocking solution 3 times and stained with the nuclear marker DAPI (Sigma–Aldrich, 1 mg/ml 1:1000) for 15 min at RT ...
-
bioRxiv - Genomics 2020Quote: ... The epithelial layer was isolated from the underlying stroma and separately digested at 37°C for 2 hours with 2 mL of 1 mg/mL collagenase A (Sigma-Aldrich Corp., St. Louis, MO, USA) in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Microbiology 2019Quote: ... 2-Amino-2-(hydroxymethyl)-1,3-propanediol (Tris; Sigma Aldrich), 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES ...
-
bioRxiv - Immunology 2019Quote: ... 2 mM Glutamax and 50 μM 2-mercaptoethanol (Sigma) (all from Thermo Fisher unless stated otherwise).
-
bioRxiv - Cell Biology 2019Quote: ... Around 2–5 μl of 2 mM levamisole (Sigma) was pipetted out on the center of the agarose pads ...
-
bioRxiv - Developmental Biology 2020Quote: ... 616452 (2 μM, Sigma-Aldrich, no. 446859-33-2) and penicillin (100 U/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1 mM 2-mercaptoethanol (2-ME; Sigma-Aldrich, USA), and 4 ng/ml FGF-2 (PeproTech ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... 2-aminoethoxydiphenyl borate (2-APB; Sigma Aldrich, Oakville, ON) experiments ...
-
bioRxiv - Biophysics 2021Quote: ... precut 2×2-well culturewell gasket (GBL103250, Sigma, MO) was attached to the coverslip ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% (v/v) phosphatase inhibitor cocktail 2 (Sigma-Aldrich) and 500 U/ml universal nuclease ...
-
bioRxiv - Immunology 2021Quote: ... plus 2 % FBS and 2 mM EDTA (Sigma-Aldrich) (from now on termed “staining buffer”) ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM Glutamax and 50 μM 2-mercaptoethanol (Sigma) (all from Thermo Fisher unless stated otherwise).
-
bioRxiv - Developmental Biology 2023Quote: ... and 200µM of 2-Mercaptoethanol (2-ME; Sigma-Aldrich).
-
bioRxiv - Neuroscience 2023Quote: ... 616452 (2 μM, Sigma-Aldrich, no. 446859-33-2) and penicillin (100 U/mL ...
-
bioRxiv - Microbiology 2023Quote: ... ≥95% pure 2’-C-methylcytidine (2’CMC; Sigma, M4949) was serially diluted in 0.5 log10 increments in Milli-Q H2O ...
-
bioRxiv - Microbiology 2022Quote: ... 2-deoxy-D-glucose (2-DG, Sigma-Aldrich, D8375), D-(+)-mannose (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were labeled using 2-aminobenzamide (2-AB, Sigma) for 2 hours at 65°C ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant human (rh) Interleukin-2 (IL-2, Sigma-Aldrich), rhTNFα (Peprotech ...
-
bioRxiv - Biophysics 2023Quote: ... 2-aminoethoxydiphenyl borate (2-APB) (Sigma-Aldrich/Merck, Germany), BL-1249 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM dimethyl-2-oxoglutarate (DMG, #349631 Sigma-Aldrich), 500 µM N-acetyl-L-cysteine (NAC ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 mM tris(2-carboxyethyl)phosphine (TCEP, Sigma-Aldrich) was added and the sample was placed on a heating plate at 500 rpm for 10 min at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... was mixed with 2-Hydroxy-2-methylpropiophenone (Sigma, #405655) at 5%(v/v ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were treated one day after seeding with 5 μM 20-hydroxy-ecdysone (Sigma) and incubated for the specified time before RNA was extracted.
-
bioRxiv - Systems Biology 2020Quote: ... First part was treated with one µL of 10 µg/mL RNase A (Sigma) for 30 min at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: Larvae or one-day old adult hermaphrodites were immobilized in 10 mM tetramisole (Sigma) and mounted on 10% agarose pads set on microscope slides ...
-
bioRxiv - Bioengineering 2020Quote: ... BCIP/NBT staining solution was prepared by dissolving one BCIP/NBT tablet (Sigma-Aldrich) in 10 mL of deionized water ...
-
bioRxiv - Bioengineering 2020Quote: ... using one of the following extracellular matrix (ECM) protein products: laminin (Laminin 111, Sigma L2020 ...
-
bioRxiv - Microbiology 2021Quote: ... and differentiated for one week in RPMI containing 10% human AB serum (H4522, Sigma), GlutaMAX ...
-
bioRxiv - Biochemistry 2021Quote: ... containing one tablet per 10 mL of cOmplete™ Protease Inhibitor Cocktail tablets (Sigma). Cell extracts were incubated on ice 30 min ...
-
bioRxiv - Bioengineering 2020Quote: ... plated on agar plates containing one-half strength Murashige and Skoog salts (Sigma-Aldrich) pH 5.7 and imbibed in the dark for 4 d at 4°C ...