Labshake search
Citations for Millipore Sigma :
5501 - 5550 of 6010 citations for Resistant Starch Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... were fluorescently labelled by the addition of 2 μl PKH26 dye (1 mM stock concentration) from the MINI26 PKH26 Red Fluorescent Cell Linker Kit (Sigma-Aldrich) and mixed by pipetting ...
-
bioRxiv - Cancer Biology 2019Quote: ... Fixed cells were washed with cold PBS and centrifuged at 2000 x g for 5 minutes and stained using a Muse™ Cell Cycle Kit (Merck Millipore) for 30 minutes in dark conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... The gDNA extractions and PCR verifying integration of the fluorescent tags into the genomic loci was performed using the REDExtract-N-Amp Tissue PCR kit (Sigma-Aldrich). PCR amplicons were run on 1 or 2% agarose gels in TBE and gels were imaged with Bio-Rad Gel ChemiDoc XRS system and Quantity One software.
-
bioRxiv - Bioengineering 2021Quote: Total RNA was isolated from 9-day-old developing Arabidopsis siliques (Van Erp et al., 2014) using the SpectrumTM Plant Total RNA Kit (Sigma-Aldrich). The isolated total RNA was then treated with DNase I (Amplification Grade ...
-
bioRxiv - Neuroscience 2021Quote: Eighteen-µm cryostat sections from the cerebrum were fixed in 4% PFA directly on slides and stained using the FragEL DNA Fragmentation Kit (QIA33; Millipore Sigma) according to manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 4 μm sections of whole lung were stained with either haematoxylin and eosin or Grocott stain (Silver stain kit, Sigma HT100A).
-
bioRxiv - Cell Biology 2021Quote: For the isolation of lysosome using ultracentrifugation method was performed following the manufacturer’s instructions (Lysosome Isolation Kit, Sigma-Aldrich, LYSISO1-1KT).
-
bioRxiv - Cell Biology 2021Quote: ... alkaline phosphatase staining was completed within each well using a commercially available Leukocyte Alkaline Phosphatase staining kit (Sigma Aldrich 86R-1KT). Whole well images were collected through brightfield microscopy and quantification of colony forming units (CFUs ...
-
bioRxiv - Cell Biology 2021Quote: ... and Spo74-mScarlet were generated at their endogenous genome locus by transformation with PCR tagging cassettes of indicated C-terminal tags using the PEG/lithium acetate yeast transformation kit (Millipore-Sigma, YEAST1). Plasmids with 2XGFP-Atg8 in pRS303 ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was isolated from 4-day-old dark-grown seedlings plus 3hrs light treatment using the Spectrum Plant Total RNA Kit (Sigma-Aldrich). One microgram of total RNA was treated with DNase I to eliminate genomic DNA and then reverse transcribed using SuperScript III (Life Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA was extracted from the frozen tissues using Spectrum™Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... pLysS cells expressing His-topoIB and T18 tagged genome segregation proteins in different combinations using the kit Protein G immunoprecipitation from Sigma-Aldrich as described previously (Maurya et ...
-
bioRxiv - Plant Biology 2020Quote: ... we extracted total RNA from pools of 6-8 shoot apical meristems (SAM) after the terminal spikelet stage from four biological replicates using the Spectrum Plant Total RNA Kit (Sigma-Aldrich). The cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 100 mg of ground-frozen samples using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich) and the RNA purity was determined through NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Scientific ...
-
bioRxiv - Physiology 2020Quote: ... 1971), MJF465 (Levina, 1999), MJF641, and MJF516 (Edwards et al., 2012) was performed using the Novagen λDE3 Lysogenization Kit (Millipore Sigma) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: RNA was extracted from 7-d-old Emmenanthe penduliflora seedlings grown in 16:8 photoperiod on moistened filter paper using Spectrum Plant Total RNA kit (Sigma-Aldrich) after removal of seed coats ...
-
bioRxiv - Microbiology 2019Quote: ... and the molecular sizes of each fraction was estimated by gel filtration molecular weight markers (Kit No: MWGF1000 of Sigma-Aldrich), and each fraction was collected for protein identification by Western blot.
-
Micro RNAs are minor constituents of extracellular vesicles and are hardly delivered to target cellsbioRxiv - Cell Biology 2020Quote: ... The EV pellet was resuspended in 200 μl of filtered PBS and stained by using the PKH26 Red Fluorescent Cell Linker Kit for General Cell Membrane Labelling (Sigma-Aldrich). The dye solution was freshly prepared by adding 4 μl of PKH26 dye to 1 ml of Diluent C ...
-
bioRxiv - Cell Biology 2020Quote: ... Medium was changed every 24 h and plates were stained for alkaline phosphatase activity to assure the efficiency of reprogramming (AP detection kit, Sigma-Aldrich). Once colonies were picked ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The supernatant was collected and centrifuged at 900g for 5mins and GLP-1 secretion over 1h treatment with GYP was measured using a total GLP-1 ELISA kit (Millipore, UK) according to manufacturer’s specifications.
-
bioRxiv - Cell Biology 2021Quote: RAW 264.7 cells were grown and used according to manufacturer’s instructions to obtain membrane fractions by differential sedimentation ultracentrifugation using a density gradient (Lysosome Isolation Kit, Sigma-Aldrich, LYSISO1). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... media was removed from wells and cells were incubated with MTT from the Cell Proliferation Kit (Sigma Aldrich, catalogue no. 11465007001), and the colorimetric assay was performed following manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... The fraction of proteins >1 kDa was obtained by dialysis using the Mini Dialysis Kit 1 kDa (Sigma #GE80-6483-94). All kits were applied according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... CHO CoV-2-Spike cells were used as target cells and were fluorescently labeled with PKH67 Fluorescent Cell Linker Kit (Sigma Aldrich) prior to incubation with mAbs ...
-
bioRxiv - Cancer Biology 2022Quote: PLA was carried out on 4% paraformaldehyde-fixed PS and PSP cells using the Duolink PLA Kit (Sigma-Aldrich, DUO92101-1KT) following the manufacturer protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... and cDNA fragments were amplified by PCR according to the manufacturer’s protocol (GenomePlex Single Cell Whole Genome Amplification Kit, Sigma Aldrich WGA4). The amplified libraries were run on a bioanalyzer to assess quality (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Osteoclast resorbed surface (Oc.S/BS) was measured following TRAP staining with Leukocyte Acid Phosphatase TRAP Kit (Sigma Aldrich, catalog # 387A-1KT). RNA was extracted from isolated whole femur for qPCR for osteoblast (Col1a1 ...
-
bioRxiv - Immunology 2022Quote: ... Cultures were stimulated with 20 ng/ml PMA for 3 hours and assessed with a mouse IFN-γ ELISA kit (Sigma-Millipore). For airway epithelial cell culture ...
-
bioRxiv - Cell Biology 2022Quote: ... ear notches were collected from mouse pups to extract genomic DNA using the RED Extract-N-Amp Tissue PCR Kit (Sigma-Aldrich). Ear notches were incubated in the tissue preparation (25 μl/sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells of the granulocytic lineage were stained on paraffin embedded tissues with the Napthol AS-D Chloracetate (Specific Esterase, CAE) Kit (Ref: 91C-1KT, Sigma-Aldrich) according to the manufacturers protocol.
-
bioRxiv - Biochemistry 2022Quote: K562 cell line derivatives were collected by centrifugation at 1400 x g for 3 mins and nuclei were isolated using the Nuclei EZ Prep nuclei isolation kit (Sigma- Aldrich). The nuclei were fixed in 4% (v/v ...
-
bioRxiv - Cancer Biology 2022Quote: ... PLA was performed using the Duolink in situ PLA kit according to the manufacturer’s instructions (Millipore Sigma, DUO92002, DUO92004 and DUO92014). In brief ...
-
bioRxiv - Microbiology 2021Quote: ... for pathological examination.Paraffin-embedded lung tissue sections were also stained for the presence of fungal structures using the Silver Stain Kit (Sigma-Aldrich), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... avidin biotin was added to attach peroxidase (ABC kit; Vector, PK-4000) and sections reacted with DAB and urea peroxidase (Sigmafast, D4293, Sigma Aldrich) until the reaction product was clearly visible.
-
bioRxiv - Microbiology 2021Quote: ... DNA was then extracted from 2 mL of cell culture using a GenElute™ Bacterial Genomic DNA Kit (Sigma-Aldrich, USA). DNA samples were subjected to an initial quality check using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was then biotinylated by click-it reaction according to the manufacturer protocol (Click-iT® Nascent RNA Capture Kit; Life technology) and precipitated with EtOH (Sigma) and Na-acetate (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... media was collected and used to measure secreted Cxcl1 protein on an ELISA plate according to the KC/Cxcl1 ELISA kit manufacturer’s instructions (Sigma-Aldrich #RAB0117). Absorbance values at 450 nm were measured with a Tecan plate reader ...
-
bioRxiv - Genomics 2020Quote: Nuclei were isolated from ~100mg of frozen frontal cortex brain tissue from Brodmann area 9 at the HIHG using the Nuclei Isolation Kit: Nuclei EZ Prep (Sigma, #NUC101). All tissues were homogenized in ice-cold EZ Lysis buffer with a glass-on-glass dounce homogenizer ...
-
bioRxiv - Microbiology 2021Quote: ... We then used these primers (TTCGTCGTGAGACAGAGCGG, AGGCCATTGACGGATGGTTTGTAC) to amplify DNA from the two positive mosquitoes using the Expand™ Long Range dNTPack kit (Sigma) using the following conditions ...
-
bioRxiv - Systems Biology 2020Quote: Genomic DNA from all the endpoint populations was extracted using GenElute Bacterial Genomic DNA Kit (NA2120; Sigma-Aldrich, St. Louis, MO) using the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was removed and the cell pellet was resuspended in 500 μL Diluent C containing 2 μL PKH67 dye (PKH67 Green Fluorescent Cell Linker Kit, Sigma-Aldrich), incubated for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... Methylated mRNA was eluted by free m6A from the beads and purified with the GenElute™ mRNA Miniprep Kit (MRN70, Sigma). One tenth of the fragmented RNA was saved as an input control for standardization ...
-
bioRxiv - Biochemistry 2021Quote: ... after 4 hours cells were fixed in 3.7% paraformaldehyde/30 mM sucrose for 10 min and processed either for the is-PLA experiment by using the Duolink PLA kit (DUO92007, Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: MCDK cell viability following exposure to GO-AgNP supernatants or vehicle was assessed using a Cytotoxicity Detection Kit (Millipore Sigma #11644793001). Prior to testing ...
-
bioRxiv - Microbiology 2021Quote: ... was prepared from an overnight culture in THB-Y broth and high-molecular-weight genomic DNA was isolated using the Sigma Genelute kit (Sigma Aldrich) according to the manufacturer′s instructions ...
-
bioRxiv - Immunology 2021Quote: ... we extracted genomic DNA from mouse tails and performed PCR with REDExtract-N-Amp™ Tissue PCR Kit following the manufacturer’s instructions (Sigma-Aldrich) and analyzed samples on agarose gel ...
-
bioRxiv - Developmental Biology 2022Quote: Mice were genotyped by PCR using ear biopsies collected within 4 weeks of birth and genomic DNA was extracted using Extract-N-Amp tissue prep kit (Sigma-Aldrich). Embryos were genotyped using either immune-reactivity to antibody raised against either STAT3 pY705 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed in 70% ethanol for 1 h and stained for 10 min with an ALP staining solution (BCIP/NBT alkaline phosphatase kit, Sigma-Aldrich), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Bacteria were lysed by bead-beating in the presence of buffer RA-1 (NucleoSpin RNA isolation kit, Mackery-Nagel) and β-mercaptoethanol (Sigma). RNA isolation and purification was continued according to the protocol supplied by the manufacturer (Nucleospin RNA isolation kit ...
-
bioRxiv - Microbiology 2022Quote: ... Isopropanol was mixed with the aqueous phase and RNA was isolated as per the GenElute Mammalian Total RNA Miniprep kit (RTN350, Millipore Sigma) protocol ...