Labshake search
Citations for Millipore Sigma :
5401 - 5450 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Single cell suspensions were washed in PBS followed by staining with 2.5 uM Fluo-3 AM (Sigma) in FACS buffer (5% FBS in HBSS ...
-
bioRxiv - Genetics 2020Quote: ... cells were UV-irradiated (10 J/m2) through isopore polycarbonate membranes containing 3-μm-diameter pores (Millipore) and experiments were performed 2hr post-UV irradiation ...
-
bioRxiv - Genomics 2021Quote: ... 100 µL of filtered must were incubated with 3 µL of DEEM (Sigma-Aldrich 87-13-8) for 30 min in a sonication bath at room temperature in a solution containing 580 µL of borate buffer (pH 9 ...
-
bioRxiv - Immunology 2021Quote: ... Optical density following development with 3-amino-9-ethylcarbazole (AEC) substrate (Sigma Aldrich, Saint Louis, MO, USA) was used to calculate the 50% micro neutralization titer (50% MN ...
-
bioRxiv - Neuroscience 2021Quote: ... or treated for 3 min with 30 µM N-Methyl-D-aspartic acid (NMDA) (Sigma-Aldrich, M3262). After 30 min slices were incubated for 10 min with AcTEV or vehicle control ...
-
bioRxiv - Microbiology 2021Quote: Poly-histidine tags were cleaved from proteins by treating them with 3 units of TEV protease (Sigma) overnight at 4 °C based on the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2021Quote: ... Protein samples were concentrated using Amicon Ultra-15 centrifugal filters (3 kDa molecular weight cut-off, Millipore). Reducing agent (2 mM DTT ...
-
bioRxiv - Cell Biology 2021Quote: ... The abdominal cavity was opened and 3 mL of 1.87 mg/mL collagenase V (Cat# C9263, Sigma;) in Hanks’ Balanced Salt Solution (HBSS ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were infiltrated with a graded series of Hexamethyldisilizane (HMDS, CAS# 999-97-3, Sigma Aldrich) in ethanol (25% - 50% - 75% - 100% - 100% ...
-
bioRxiv - Bioengineering 2022Quote: Cleaned coverslips (22 mm) were treated at room temperature with 3-amino-propyl triethoxy silane (Sigma Aldrich) and incubated with 0.5% glutaraldehyde solution (SDFC Ltd. ...
-
bioRxiv - Biochemistry 2020Quote: ... dechorionated with 8.25% sodium hypochlorite in water for 3 min and finally washed with PBS (Millipore Sigma). The embryos were suspended and washed in a microcentrifuge tube containing 1 mL of PBS ...
-
bioRxiv - Bioengineering 2021Quote: ... The dried compound 3 was treated with Amberlite IRA 400 chloride ion exchange resin (Sigma, Cat.# 247669) in dimethylsulfoxide-water mixture (1:1 ...
-
bioRxiv - Biochemistry 2020Quote: The glycopeptides were enriched by ZIC-HILIC method using ProteoExtract® Glycopeptide Enrichment Kit (Millipore, 72103-3) with a modified procedure ...
-
bioRxiv - Neuroscience 2021Quote: Third-instar larval preparations were fixed for 3 min with Bouin’s fixative (100%, Sigma-Aldrich, HT-10132) for confocal microscopy ...
-
bioRxiv - Neuroscience 2020Quote: ... mounted on slide glass or coverslips and postfixed with 4% PFA in PB or 3% glyoxal (Sigma) for 2 h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... washed in HBSS without Ca2+ and Mg2+ and embedded in 3% low-gelling-temperature agarose (Sigma, A9414) at 40°C in embedding molds (Sigma ...
-
bioRxiv - Biophysics 2020Quote: ... Sulforhodamine-1,2-dihexanoyl-sn-glycero-3-phosphoethanolamine (Texas Red DHPE) was purchased from Sigma-Aldrich (Taufkirchen, Germany) and silicon wafers from Silicon Materials (Kaufering ...
-
bioRxiv - Cell Biology 2021Quote: ... The clarified lysate was retrieved and added to 3 mL packed anti-FLAG M2 agarose resin (Sigma) and incubated with gentle mixing at 4°C for 16 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... grown for 2.5 hours and arrested by adding 3 μg/ml α-factor (Sigma, custom peptide WHWLQLKPGQPMY) every 60 min for 120 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 25 µg/ml L-ascorbic acid and 3 mM sodium dihydrogen phosphate (all from Sigma-Aldrich, Germany) for 21 days with medium being changed every other day.
-
bioRxiv - Cell Biology 2021Quote: ... Protein degradation rate was measured after 3-hour treatment with 20μg/ml of cycloheximide (Sigma-Aldrich #C7698) in the complete RPMI medium ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... containing the internal standard sodium 3-(trimethylsilyl)propionate-2,2,3,3,-d4 (TSP, 98 atom % D, Sigma-Aldrich, Milan) at a 0.6 mM final concentration ...
-
bioRxiv - Biochemistry 2020Quote: Erythrocytes were washed 3 times with an equal volume of RPMI-1640 media (Sigma-Aldrich, SKU R4130) supplemented with ...
-
bioRxiv - Bioengineering 2021Quote: ... scaffolds (n = 3) were submerged into 500 μL of 4 M guanidine hydrochloride (GuHCl, Sigma-Aldrich, Canada) buffer supplemented with a protease inhibitor (Roche Applied Science ...
-
bioRxiv - Bioengineering 2021Quote: ... 48 h and day 21 hBMMSC-seeded scaffolds (n=3) were fixed in 4% paraformaldehyde (Sigma, Canada) for 1 hour and submerged in gradient sucrose solutions from 10% to 30% ...
-
bioRxiv - Microbiology 2020Quote: ... while the upper one (22×40 mm Marienfeld) was functionalized with 3-(Trimethoxysilyl)propyl methacrylate (Sigma-Aldrich) following the standard procedure ...
-
bioRxiv - Plant Biology 2021Quote: ... This solution was replaced with 800 μl of 0.01% ruthenium red solution (11103-72-3, Sigma-Aldrich). The seeds were again shaken vigorously on an orbital shaker for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... The mCherry plasmid was created by cloning mCherry into the multiple cloning site of pTriEx-3 (Novagen) using the Gibson Assembly Cloning Kit (New England BioLabs) ...
-
bioRxiv - Biophysics 2021Quote: ... The bottom slides are silanized by dipping them in a solution of (3-aminopropyl)-trimethoxysilane (Sigma-Aldrich) 0.1% v/v for 30 minutes in ethanol ...
-
bioRxiv - Microbiology 2021Quote: ... The membrane was washed 3 times with PBS with 0.01% Tween®20 (Sigma, St. Louis, MO). Secondary antibody was incubated at room temperature protected from light for 1 hour in Intercept®(TBS ...
-
bioRxiv - Physiology 2021Quote: ... rinse 3 times in 1XPBS without detergent and stained with Nile red (Cat. No. 72485, Sigma-Aldrich) or Bodipy™ 493/503 (Cat ...
-
bioRxiv - Plant Biology 2020Quote: ... a DNA oligonucleotide reverse complement to U6 was 3’-end-labelled with Digoxigening-11-ddUTP (Sigma, USA) using a Terminal Deoxynucleotidyl Transferase (TdT ...
-
bioRxiv - Zoology 2021Quote: 200 mg Et-IPA (a-Ethyl-3-hydroxy-2,4,6-triiodohydrocinnamic acid, CAS 96-84-4, Sigma Aldrich) was dissolved in 4 ml edible corn oil ...
-
bioRxiv - Microbiology 2020Quote: ... roots were hand sectioned from 3 cm above the tips and stained with 0.2% Basic Fuchsin (Sigma). To image GFP and Basic Fuchsin fluorescence ...
-
bioRxiv - Cancer Biology 2020Quote: ... wells were washed three times as quickly as possible with ice-cold blood bank saline and lysed on the dish with 700μL of (4:3) methanol:0.88% KCl in water with 0.25μg/mL tridecanoic acid (Sigma, T0502) to use as an internal extraction standard ...
-
bioRxiv - Cell Biology 2021Quote: ... which was chilled and mixed with 3 μl of cold thrombin (at 100 U/ml; Sigma-Aldrich) just before pipetting into the agarose casting troughs ...
-
bioRxiv - Biophysics 2020Quote: ... resulting in a hydrophobic surface for sandwiching the curing hydrogel or with 3-(Trimethoxysilyl)propylmethacrylate (Sigma Aldrich) resulting in free methacrylate groups for crosslinking of PEGDA hydrogels to the surface.
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Cell Biology 2021Quote: Permeabilisation and blocking were undertaken by incubating cells in ‘blocking buffer’ consisting in 3% BSA (Sigma-10735108001) & 0.5% Triton X-100 (Sigma-X100 ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was blocked with tris-buffered saline containing 3% bovine serum albumin (cat. A7030, Sigma-Aldrich) and 0.1% Tween 20 (P1379 ...
-
bioRxiv - Biophysics 2022Quote: ... The region in the stencil was treated with (3-aminopropyl)triethoxysilane (APTES, Sigma-Aldrich, cat. no. A3648) diluted at 5% in absolute ethanol for 3 min ...
-
bioRxiv - Neuroscience 2022Quote: ... brain slices were blocked for 2h at RT (3% normal donkey serum [Sigma D9663], 0.1% triton-x), stained with 1’ ab for 12h at 4°C (EMD Millipore [ab144P ...
-
bioRxiv - Pathology 2022Quote: ... 3% BSA) and re-suspended (500µL per kidney) in low salt buffer (20mM HEPES-KOH, Sigma Aldrich #H0527 ...
-
An in vitro neuronal model replicating the in vivo maturation and heterogeneity of perineuronal netsbioRxiv - Neuroscience 2022Quote: ... Non-specific binding sites were blocked by incubation with 3% (v/v) normal donkey serum (Sigma #D9663) in 1X Tris buffered saline (TBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... washed three times in PBS and blocked in a solution containing 3% bovine serum albumin (BSA; Sigma), 5% horse serum (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... ADC scaffolds (n = 3) were gently agitated in 4 M guanidine hydrochloride buffer (GuHCl, Sigma-Aldrich, Canada) supplemented with a protease inhibitor (Roche Applied Science ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were eluted by the addition of elution buffer containing 3 x Flag peptide (Sigma, cat. #F4799) at 4°C for 30 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... the slabs were incubated with or without 3 ng/ml ACTH1-24 (Synachthen, Sigma-tau Arzneimittel GmbH) for 24 h ...
-
bioRxiv - Immunology 2022Quote: ... and concentrated to 3 mg/ml using the Amicon ultrafiltration units with 10 kDa cutoff (EMD Millipore).
-
bioRxiv - Physiology 2022Quote: ... To visualize traces the probes were covered with fluorescent (green light) dye (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Sigma). LFP signals from the probes were acquired using a Digital Lynx amplifier (Neuralynx ...