Labshake search
Citations for Addgene :
201 - 250 of 1322 citations for PDGF BB Human P.pastoris since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... LTD and ligated into the Bbs I sites of pX330 vector (42230, Addgene) to form the intact targeting plasmids.
-
bioRxiv - Molecular Biology 2021Quote: ... the puromycin resistance gene in pSpCas9(BB)-2A-Puro (PX459; Addgene plasmid #62988)61 was replaced by either mCherry or iRFP670 using PCR and fragment assembly ...
-
bioRxiv - Cell Biology 2021Quote: ... with the pSpCas9(BB)-2A-GFP plasmid (Cat# 48138, Addgene, Cambridge, MA, USA) according to the manufacturer’s instructions (34) ...
-
bioRxiv - Cell Biology 2020Quote: ... program X-005 with the pSpCas9(BB)-2A-Puro (PX459) vector (Addgene, #62988) bearing the appropriate targeting sequence (KIF21B ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gene-specific gRNAs were integrated into pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) and 2 μg of plasmid was electroporated into 106 cells using a Lonza 4D-NucleofectorTM according to the manufacturer’s protocol for HCT116 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2021Quote: ... The pSpCas9 (BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138 ...
-
bioRxiv - Cell Biology 2022Quote: ... pSpCas9(BB)-2A-GFP was a gift from Feng Zhang (Addgene plasmid #48138). pSpCas9(BB)-2A-mCherry was constructed by replacing GFP with mCherry ...
-
bioRxiv - Immunology 2022Quote: ... pSpCas9(BB)-2APuro (PX459) was a gift from Feng Zhang (Addgene plasmid #48139) or PX458 containing an eGFP cassette ((53) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAACCTGAGCCCGCGACCACACCC –bottom for Sox21NHEJ5) were cloned into pSpCas9(BB)-2A-Puro (px459; Addgene) and designated the plasmid as pX459-Sox21NHEJ4 and pX459-Sox21NHEJ5 ...
-
bioRxiv - Cell Biology 2023Quote: CRISPR-Cas9 plasmids were as follows: pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene 62988 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene # 62988). Both donor and sgRNA plasmids for SIX2 reporter knockin were transfected into the H1 hESCs using the Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pSpCas9 (BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988, Addgene, Teddington, UK) was modified by an EF1alpha promoter25 ...
-
bioRxiv - Genomics 2023Quote: ... This gRNA was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) via the Zhang lab protocol (https://media.addgene.org/data/plasmids/62/62988/62988-attachment_KsK1asO9w4owD8K6wp8.pdf) ...
-
bioRxiv - Cell Biology 2022Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Biophysics 2023Quote: ... The gRNAs were subcloned into Bbs I- digested PX458 vector (Addgene plasmid #48138) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNAs were cloned into either pSpCas9(BB)-2A-GFP (Addgene Plasmid #48138) or pSpCas9(BB)-2A-mCherry as described previously (Ran et al ...
-
bioRxiv - Molecular Biology 2023Quote: pSpCas9(BB)-2A-GFP was a gift from Feng Zhang (pX458, Addgene #48138;) (Ran et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... the vector pSpCas9n(BB)-2A-GFP (PX461) (Addgene, Watertown, MA, USA, Cat # 48140) was used ...
-
bioRxiv - Microbiology 2023Quote: S10-3 cells were transfected with the pSpCas9(BB)-2A-GFP (Addgene #48138) plasmid encoding the Cas 9 protein fused to GFP by the 2A peptide ...
-
bioRxiv - Cell Biology 2023Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Molecular Biology 2024Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pSpCas9(BB)-2A-Puro (PX459) a gift from Feng Zhang (Addgene # 48139) (Kirschke et al. ...
-
bioRxiv - Genetics 2021Quote: GFP-expressing pSpCas9(BB)-2A-GFP (PX458) (gift from Feng Zhang, Addgene plasmid #48138). Three crRNAs targeting human TMEM67 (RefSeq NM_153704.5 ...
-
bioRxiv - Developmental Biology 2020Quote: ... These complementary oligos were annealed and cloned into pSpCas9(BB)-2A-Puro vector (Addgene). Plasmids containing guideRNA target sites were confirmed by sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: sgRNAs were cloned into the pSpCas9(BB)-2A-Puro(PX459)-V2.0 vector (Addgene #62988) by annealing oligonucleotides 1 and 2 (Table S3 ...
-
bioRxiv - Cell Biology 2022Quote: ... Annealed gRNA oligonucleotides were inserted into the pSpCas9n(BB)-2A-GFP plasmid (Addgene, PX458) and the construct was transfected into RPE1 cells using Lipofectamine LTX with PlusReagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cas9 plasmid (pSpCas9(BB)-2A-BFP (a modified version of PX458 (Addgene plasmid # 48138), in which eGFP is replaced for tagBFP) ...
-
bioRxiv - Developmental Biology 2020Quote: ... sgRNAs were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Feng Zhang Lab; Addgene plasmid #62988 ...
-
bioRxiv - Genetics 2020Quote: ... The selected sgRNAs (Table 1) were cloned into plasmid pSpCas9(BB)-PX330 (Addgene #42230), using the BbsI site ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA complementary oligonucleotide templates were cloned into pSpCas9(BB)-2A-Puro (Addgene, #48139) or pSpCas9(BB)-2A-GFP (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: Guide RNA sequences were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene plasmid 48139) for expression ...
-
bioRxiv - Cell Biology 2021Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138). The Hec1-GFP Wt and 9A mutant plasmids were a gift of Jennifer DeLuca ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNAs were subsequently cloned into the pSpCas9(BB)-2A-Puro(PX459)V2.0 vector (Addgene). 2µg/ml puromycin (InvivoGen ...
-
bioRxiv - Immunology 2021Quote: ... The sgRNA sequence was cloned into the pSpCas9 (BB)-2A-GFP plasmid (pX458, Addgene). The construct was then independently transfected into HEK293T cells ...
-
bioRxiv - Cell Biology 2022Quote: ... guide RNAs targeting ELKS (ERC1) were cloned into pSpCas9(BB)V2.0 (Addgene plasmid #62988)63 ...
-
bioRxiv - Genomics 2019Quote: We used pSpCas9(BB)-2A-Puro (PX459) V2.0 [a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Genetics 2019Quote: pSpCas9(BB)-2A-Puro (PX459) was used to construct CRISPR/Cas9 vectors (Addgene 48139). The following gRNA oligos were cloned into the BbsI restriction site:
-
bioRxiv - Microbiology 2020Quote: ... pSpCas9(BB)-2A-GFP (pX458) was a gift from Feng Zhang (Addgene plasmid # 48138) (Ran et al ...
-
bioRxiv - Genetics 2021Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138). The homology-directed repair template was designed based on the pFETCh_Donor plasmid from the CETCh-seq protocol (Savic et al. ...
-
bioRxiv - Genetics 2020Quote: ... and the Cas9-BGH fragment from pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene; 62988) (Ran et al ...
-
bioRxiv - Genetics 2020Quote: ... gRNA-containing plasmids were generated in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene; 62988) (Ran et al ...
-
bioRxiv - Cell Biology 2021Quote: ... and selected guide sequences cloned into pSpCas9(BB)-2A-Puro (Addgene plasmid ID: 48139). Following overnight transfections (described above) ...
-
bioRxiv - Neuroscience 2021Quote: ... gRNAs were cloned into the vector pSpCas9(BB)-2A-GFP (PX458) (Addgene cat#48138). The CRISPR MDGA2 resitant sequence was the same as for shMDGA2 since the gRNA for MDGA2 was directed to the signal peptide ...
-
bioRxiv - Biochemistry 2021Quote: ... was cloned between Bbsl sites of the pSpCas9(BB)-2A-Puro-V2.0 (62988, Addgene). The plasmid pUC57-NASP-FKBP12F36V ...
-
bioRxiv - Developmental Biology 2020Quote: ... gRNAs were individually cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) (Ran et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... Annealed double strand DNAs were ligated into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene) at the Bpi1 (Bbs1 ...