Labshake search
Citations for Addgene :
451 - 500 of 1322 citations for PDGF BB Human P.pastoris since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... This again was followed by the cloning of these sgRNAs into the bicistronic Cas9n expression vector pSpCas9n(BB)-2A-Puro (PX462) V2.0 (Ran et al, 2013b) kindly provided by Feng Zhang (Addgene plasmid #62987 ...
-
bioRxiv - Developmental Biology 2020Quote: ... PX459-sgRosa26-1 was generated by inserting the guide RNA sequence targeting Rosa26 (Table S3) into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene) via restriction ligation with BbsI.
-
bioRxiv - Cell Biology 2020Quote: The PIK3C2A knockout cell line was generated by transfecting HeLa cells with pSpCas9(BB)-2A-GFP (pX458, Addgene #48138) into which a single guide (5’-CACCGAGCACAGGTTTATAACAAGC-3’ ...
-
bioRxiv - Immunology 2021Quote: ... a pair of sgRNAs were designed for a target sequence in exon 3 of the mouse CD274 (coding for PD-L1) gene using the online tool at http://crispr.mit.edu and were cloned into pSpCas9n(BB)-2A-GFP (Addgene, #48140). LECs were transfected with the vectors using polyethylenimine as described (Hsu and Uludag ...
-
bioRxiv - Developmental Biology 2022Quote: Nek2 sgRNAs (Supplementary Table 1) were cloned into the CRISPR-Cas9 plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid 62988 ...
-
bioRxiv - Cancer Biology 2022Quote: sgRNAs targeting the STK11 locus were designed using CHOP-CHOP and cloned into pSpCas9(BB)-2A-GFP (Addgene #48138). KRAS-mutant NSCLC cell lines were transiently transfected with the plasmids and sorted for single clone formation by FACs ...
-
bioRxiv - Cell Biology 2022Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138; http://addgene.org/48138; RRID: Addgene_48138) (43) ...
-
bioRxiv - Neuroscience 2023Quote: ... A short guide RNA (sgRNA) was designed (GTCAAACCTGTCACCAGTTG) and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, #62988) according to a previously published protocol 31 ...
-
bioRxiv - Developmental Biology 2023Quote: A short guide RNA (sgRNA) sequence (GCTGCTGGTGTGCCCCGGGCTGG) was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) as outlined in 49 ...
-
bioRxiv - Physiology 2023Quote: ... for generation of isogenic control lines were designed using an online tool (crispr.mit.edu) and ordered as oligos to be cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: Plasmids pSpCas9(BB)-2A-Puro (PX459) and pCMV-VSVG plasmid (pMD2.G) were kind gifts from Feng Zhang15 (Addgene plasmid #62988 ...
-
bioRxiv - Biochemistry 2022Quote: ... and sgRNA oligos synthesized from IDT were annealed and cloned into pSpCas9(BB)-2A-Puro (PX459)-V2.0 (Addgene; 62988). Homology arms for the donor vector were amplified via PCR from digested DNA fragments of genomic DNA purified from mES cells and cloned into a premade pUC19-HT vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... 101000053) according to the manufacturer’s instructions with pSpCas9(BB)-2A-GFP (PX458) plasmid (a gift from Feng Zhang; Addgene plasmid #48138 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Oligonucleotide duplex corresponding to these gRNAs were inserted into the pSpCas9n(BB)-2A-Puro (PX459) V2.0 vector (62988, Addgene) or lentiCRISPR v2 vector (52961 ...
-
bioRxiv - Cell Biology 2023Quote: ... were ordered from Sigma Aldrich as oligonucleotides (Table 2) and were cloned into pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138 ...
-
bioRxiv - Cell Biology 2023Quote: ... gRNAs were sub-cloned into vector pSpCas9(BB)-2A-Puro (PX459) (Addgene, 48139, deposited by the F. Zhang lab), and gRNA plasmids for targeting PRKAA1 and PRKAA2 were co-transfected into cells with TransIT-LT1 (Mirus ...
-
bioRxiv - Neuroscience 2023Quote: ... a guide sequence targeting exon 4 and 5 was cloned in the pSpCas9(BB)-2A-Puro construct (Addgene 48139). For βTC3 cells ...
-
bioRxiv - Microbiology 2023Quote: ... USA) and cloned into the pSpCas9(BB)-2A-GFP (PX458) plasmid which was a gift from Feng Zhang (Addgene plasmid #48138 ...
-
bioRxiv - Cell Biology 2023Quote: ... and were cloned into pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138; http://n2t.net/addgene:48138; RRID: Addgene_48138) containing pSpCas9 and an eGFP reporter cassette ...
-
bioRxiv - Cell Biology 2023Quote: ... targeting AP4M1 were designed using CHOPCHOP (https://chopchop.cbu.uib.no/) and cloned into pSpCas9(BB)-2A-GFP (pX-458) vector (Addgene plasmid #48138) at the BbSI restriction site as described (Ran ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Cancer Biology 2021Quote: The expression vector pspCas9(BB)-2A-Puro (PX459) used for UPP1 CRISPR/Cas9 construct was obtained from Addgene (Plasmid #48139). The plasmid was cut using the restriction enzyme BbsI followed by the insertion of UPP1 sgRNAs (Table 2 ...
-
bioRxiv - Cell Biology 2020Quote: ... designed by Life technologies to target the second exon of murine Vangl2 (gRNA: 5’-TCGGCTATTCCTACAAGTC-3’) into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138). Upon transfection ...
-
bioRxiv - Developmental Biology 2022Quote: Oligo DNAs of the target sequence were ligated into the BbsI site of the pSpCas9(BB)-2A-Puro (pX459) V2.0 plasmids (Addgene #62988). The combination of #1 and #2 or #3 and #4 oligos was used to establish Fgf10-KO ESCs ...
-
bioRxiv - Genomics 2020Quote: ... CRISPR editing was performed as described previously2 using Cas9 plasmids pSpCas9(BB)-2A-Puro (PX459) V2.0 (a gift from F. Zhang, Addgene 62988) or pCas9_GFP (a gift from K ...
-
bioRxiv - Cell Biology 2019Quote: ... DDRGK1 and UFL1 knockout cell lines were generated by transient transfection of two pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) plasmids carrying sgRNAs that each target the downstream and upstream regions of the transcription start site ...
-
bioRxiv - Neuroscience 2019Quote: ... The original CBh promoter in pSpCas9(BB)-2A-GFP plasmid was then replaced with the CAGGs promoter from pCAGGs–mCherry (#41583, Addgene). The obtained pCAGGs-Cas9(BB)-2A-GFP-gRNA plasmid was subsequently used for the in vitro experiments ...
-
bioRxiv - Neuroscience 2019Quote: ... The oligonucleotides to generate the gRNAs (Integrated DNA Technologies) were annealed in vitro and cloned in the BbsI sites of the pSpCas9(BB)-2A-GFP plasmid (#48138, Addgene). The original CBh promoter in pSpCas9(BB)-2A-GFP plasmid was then replaced with the CAGGs promoter from pCAGGs–mCherry (#41583 ...
-
bioRxiv - Genomics 2019Quote: ... A 20bp guide (GGGAGACAGAGCTTTCGACA-129S1 or GGAGACACAGCTTTCGACA-WSB) was cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). 2×106 cells seeded on a 60mm dish were co-transfected with equimolar amounts (2.5ug each ...
-
bioRxiv - Genomics 2019Quote: ... A guide targeting the last coding exon of Nanog (CCACTTTATACTCTGAATGC) was cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). 5×105 cells seeded on a 12-well plate were co-transfected with equimolar amounts (0.5ug each ...
-
bioRxiv - Genetics 2020Quote: ... pX458 (pSpCas9(BB)-2A-GFP) was a gift from Feng Zhang (Broad Institute) and is available from Addgene (plasmid #48138). HUDEP-2 cells were then transfected as previously described55 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Two complementary oligonucleotides were annealed and cloned into BbsI site of pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) for co-expression with Cas9 using 5U of T4 DNA ligase ...
-
bioRxiv - Cell Biology 2021Quote: ... The HeLa GFP-RAB7 line was generated by transfecting HeLa cells (ATCC) with the donor plasmid pDONOR-GFP-RAB7 and pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, #62988) bearing the appropriate targeting sequence (5’-TAGTTTGAAGGATGACCTCT-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... For CRISPR Cas9 KO generation two gRNA directed to exon 4 and exon 5 (Table M1) were cloned in pSpCas9 (BB)-2A-Puro V2.0 (Addgene #62988).
-
bioRxiv - Neuroscience 2020Quote: ... and pX330-U6-Chimeric_BB-CBh-hSpCas9 were a gift from Feng Zhang (Addgene plasmid # 48140, 42230; http://n2t.net/addgene:48140; RRIDs: Addgene_48140, Addgene_42230).
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA (sgRNA) targeting exon 4 of TP53 (5’-CTGTCATCTTCTGTCCCTTC-3’) was cloned into pSpCas9(BB)-2A-GFP (pX458, plasmid #48138, Addgene). pSpCas9(BB)-2A-GFP was a kind gift from dr ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs expressing Cas9 and either gRNA were generated by cloning into pSpCas9(BB)-2A-Puro (PX459) vectors (Addgene plasmid #48139). Individual vectors were transfected into U2OS cells using TransIT-LT1 reagent (Mirus ...
-
bioRxiv - Cell Biology 2021Quote: ... the CRISPR-Cas9 system used to generate the null lines involved use of a plasmid obtained from Addgene (pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cancer Biology 2022Quote: Single-guide RNAs (sgRNAs) targeting genes of interest were designed and cloned into the pSpCas9(BB)-2A-Puro vector (pX459) V2.0 (Addgene #62988) using Golden Gate Cloning as described [29] ...
-
bioRxiv - Molecular Biology 2020Quote: ... sgRNAs were designed using the CRISPOR online tool (Haeussler et al., 2016) and cloned into pSptCas9(BB)-2A-Puro(PX459)-V2.0 (Addgene #62988) as previously described (Ran et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... sgRNAs in Table S1 were cloned in pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138) and transfected into mESCs ...
-
bioRxiv - Cancer Biology 2021Quote: ... guide sequences (Table S6) targeting the SIRT5 locus were inserted into pSpCas9(BB)-2A-Puro (PX459) backbone (Addgene catalog #62988). Guide sequences were designed based on previous CRISPR screens (95 ...
-
bioRxiv - Cancer Biology 2021Quote: ... We cloned guideRNAs into the pSpCas9(BB)-2A-Puro V2.0 (PX459) plasmid using BbsI restriction sites (Addgene plasmid #62988, (69)) ...
-
bioRxiv - Microbiology 2022Quote: ... the resultant dsDNA fragment was golden gate cloned in the BbsI sites of pSpCas9(BB)-2A-Puro V2.0 (Addgene #62988) or pSpCas9ΔNLS(BB)-2A-Puro plasmids ...
-
bioRxiv - Systems Biology 2022Quote: ... The gRNAs were cloned into the pSpCas9(BB)-2A-GFP vector (PX458; a gift from Feng Zhang; Addgene plasmid #48138) using annealed reverse complementary guide DNA oligos ...
-
bioRxiv - Genetics 2019Quote: ... Guide sequences with an aggregate score of greater than 50% were selected and cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene) or pSpCas9(BB)-2A-RFP (modified from PX458 ...
-
bioRxiv - Physiology 2020Quote: ... LRMP- and IRAG-specific gRNA sequences were cloned into the pSpCas9(BB)-2A-GFP vector (Addgene, Watertown, MA; Cat. #PX458). Two distinct cut sites were used for each IRAG (XM_027410089.1 ...
-
bioRxiv - Biochemistry 2019Quote: ... The sgRNA oligos were then cloned into the pSpCas9(BB)-2A-GFP (PX458) vector (a kind gift from Feng Zhang [Addgene plasmid # 48138 ...