Labshake search
Citations for Addgene :
1 - 50 of 1322 citations for PDGF BB Human P.pastoris since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Human iPSCs were edited using the pSpCas9(BB)-2A-GFP (PX458) construct backbone (Addgene #48138) described in Ran et al 201380 ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... pSpCas9(BB) (PX330) (Addgene). Targeting was done for the 5’ and CR4/5 sites ...
-
bioRxiv - Cell Biology 2020Quote: pSpCas9(BB)-2A-mCherry was generated from pSpCas9(BB)-2A-GFP (Addgene, plasmid #48138) by removing EGFP and the T2A sequence via EcoRI digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pSBbi-BB (Addgene #60521) plasmids digested by the SfiI restriction enzyme ...
-
bioRxiv - Neuroscience 2021Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 and pSpCas9(BB)-2A-GFP (PX458) were purchased from Addgene. Custom oligonucleotides were generated (GluN2A forward ...
-
bioRxiv - Molecular Biology 2020Quote: ... pSpCas9n(BB)-2A-GFP (PX461) (Addgene plasmid # 48140 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pSpCas9(BB)-2A-GFP (Addgene #48138) between BsmBI sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... pSpCas9(BB)-2A-Puro (Addgene #48139) using Lipofectamine LTX & Plus Reagent (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... pSpCas9(BB)–2A–Puro (62988, Addgene). The resulting plasmid was transfected into the wild-type human iPSCs using Lipofectamine (CMAX00015 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The plasmid construct targeting exon 2 of human AIRE (AIREKO) was created using pSpCas9(BB)-2A-GFP (a gift from Dr. Feng Zhang, #48138, Addgene, http://n2t.net/addgene:48138 ...
-
bioRxiv - Genomics 2023Quote: ... cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Genomics 2020Quote: ... pSpCas9(BB)-2A-Puro (PX459, Addgene #62988) was a gift from Feng Zhang.
-
bioRxiv - Molecular Biology 2020Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988 ...
-
bioRxiv - Genetics 2020Quote: pSpCas9 (BB)-2A-Puro (PX459) vector (Addgene), encoding Cas9 ...
-
bioRxiv - Genomics 2021Quote: ... and pspCas9(BB)-2A-RFP (Addgene; # 91854), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... or pSpCas9(BB)-2A-GFP (Addgene, #48138) plasmids after BbsI (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... pSpCas9 (BB)-2A-Puro (PX459) (Addgene # 62988) by using complimentary oligonucleotide pairs ...
-
bioRxiv - Cell Biology 2020Quote: ... or pSpCas9(BB)-2A-miRFP670 (Addgene #91854), used for targeting FABP5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pSpCas9(BB)-2A-Hygro (pX459_hygro, Addgene #127763) or pSpCas9(BB)-2A-Blast (pX459_blast ...
-
bioRxiv - Cell Biology 2023Quote: ... pSpCas9(BB)-2A-GFP (Addgene plasmid, #PX458) was used as the vector to generate a gRNA of both CEP170 and CEP170B ...
-
bioRxiv - Immunology 2024Quote: ... pSpCas9(BB)–2A-puro (pX459) (Addgene, #48139).
-
bioRxiv - Immunology 2024Quote: ... pSpCas9(BB)–2A-GFP (pX458) (Addgene #48138), pSpCas9(BB)–2A-puro (pX459 ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cloned into pSpCas9(BB)-2A-GFP (pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138 ...
-
bioRxiv - Cell Biology 2024Quote: ... pSpCas9(BB)-2A-Halo was generated by replacing GFP with HaloTag in pSpCas9(BB)-2A-GFP (PX458) (Addgene #488138). SUM159 cells were transfected with 1000 ng of the plasmid containing the sgRNA targeting sequence using Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene, Cambridge, MA) following the depositor’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Genetics 2021Quote: ... pSpCas9n(BB)-2A-GFP (PX461) and pSpCas9n(BB)-2A-Puro (PX462) was a gift from Feng Zhang (For PX461, Addgene plasmid#48140 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The guide sequence selected was constructed into pSpCas9(BB)-2A-Puro (PX459) [pSpCas9(BB)-2A-Puro(PX459) was a gift from Feng Zhang (Addgene plasmid #62988 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the duplexes were cloned into pSpCas9n (BB) (PX460) and pSpCas9(BB)-2A-GFP (PX458) (a gift from Dr Fang Zhang, Addgene plasmid #48873 and #48138 ...
-
bioRxiv - Biophysics 2021Quote: ... pSPCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) and pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A ...
-
bioRxiv - Genomics 2021Quote: ... and pSpCas9(BB)-2A-Puro (PX459, Addgene #48139). Two guides were designed per enhancer (Supplementary Table S2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pSpCas9n(BB)-2A-GFP (Addgene, Cambridge, MA, USA) was mutagenized by PCR amplification ...
-
bioRxiv - Neuroscience 2021Quote: ... the pSpCas9(BB)-2A-Puro (PX459: Addgene, 62988) plasmid was used carrying a gRNA targeting MPHOSPH8 (clone C7 and C11 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) backbones ...
-
bioRxiv - Cancer Biology 2022Quote: pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) was provided by Feng Zhang 35 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or px459-pSpCas9(BB)-2A-Puro (Addgene #62988), respectively ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) using the AgeI and EcoRI restriction sites ...
-
bioRxiv - Neuroscience 2021Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) was cloned with an oligonucleotide designed to target MECP2 exon 3 using benchling.com CRISPR prediction tool (described in Table S2) ...
-
bioRxiv - Physiology 2020Quote: ... The pSpCas9(BB)-2A-Puro construct (Addgene 48139) was used to clone the guide sequences ...
-
bioRxiv - Developmental Biology 2020Quote: ... pMXs Klf4 and pSpCas9(BB)-2A-GFP (Addgene). pPyCAG-MST-IRES-Puro ...
-
bioRxiv - Immunology 2019Quote: ... pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid # 48138), pY010 (pcDNA3.1-hAsCpf1 ...
-
bioRxiv - Physiology 2022Quote: ... using a pSpCas9(BB)−2A-GFP (PX458, Addgene) vector ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pSpCas9 (BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or pSpCas9(BB)-2A-Blast (pX459_blast, Addgene #118055).
-
bioRxiv - Cell Biology 2023Quote: ... pSpCas9 (BB)-2A-GFP (PX458) (Addgene, Cat. #48138), and then cloned into competent E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pSpCas9(BB)-2A-GFP(PX458) (Addgene #48138) with BbsI (NEB ...