Labshake search
Citations for Addgene :
201 - 250 of 472 citations for NGS ChIP Seq kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... transfection reagent with 60 ng of LwaCas13a plasmid (Addgene ID 91924), 20 ng of gRNA plasmid (generated by cloning oligos into an LwaCas13a crRNA entry plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... or 50 ng of a mitochondrial marker (eBFP2-Mito, Addgene: 55248). The next day ...
-
bioRxiv - Cancer Biology 2022Quote: ... and either 340 ng of pCEF-VSV-G (Addgene plasmid # 41792) or 680ng of 2.2 (Addgene plasmid # 34885 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 500 ng packaging plasmid psPAX2 (gift from Didier Trono, Addgene #12260), and 250 ng envelope plasmid pMD2.G (gift from Didier Trono ...
-
bioRxiv - Cell Biology 2021Quote: ... and transfected with 333 ng each of hCas9 (Addgene plasmid # 41815); 48 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and either 750 ng of Spike-18aa truncated (Addgene plasmid # 149541), or generated Spike variant plasmids (alpha ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 µL plasmid DNA (ERmoxGFP43, Addgene Cat. # 68072, 420 ng/µL), and 96 µL of PBS ...
-
bioRxiv - Systems Biology 2019Quote: ... 90 ng pLR5-CBh-dCas9-hUtx-IRES-Hyg (Addgene, Plasmid #122374), 10 ng pCAG hyPBase [64] plasmids were transfected using Lipofectamine 3000 (Cat# L3000015 ...
-
bioRxiv - Cell Biology 2020Quote: 100 ng of human sgRNA library Brunello in lentiCRISPRv2 (Addgene, #73179) was transformed into electrocompetent Endura cells (#60242 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 500 ng of pMD2.G (VSV-G) (Addgene plasmid #12259), using Lipofectamine 2000 at a ratio of 1:2.5 (Life Technologies) ...
-
bioRxiv - Genomics 2022Quote: ... Cells were transfected with pMD2.G (500 ng, Addgene plasmid #12259), psPAX2 (1500 ng ...
-
bioRxiv - Microbiology 2023Quote: ... containing either 1000 ng empty vector (EV) (Addgene plasmid # 10841 (108)) ...
-
bioRxiv - Immunology 2024Quote: ... 200 ng of envelope plasmid (Addgene #8454; courtesy of Bob Weinberg), and 6 of μL polyethyleneimine (PEI ...
-
bioRxiv - Immunology 2024Quote: ... 800 ng of packaging plasmid (Addgene #8455; courtesy of Bob Weinberg), 200 ng of envelope plasmid (Addgene #8454 ...
-
bioRxiv - Genomics 2023Quote: ... The oligomer sequence was obtained from the data and the surrounding sequence was retrieved from the human STAP-seq screening vector sequence (Addgene ID: 125150). Both basepair level and TSS-level prediction and experimental measurements were compared ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2 ng/μl RNase-free plasmid DNA (pX330, Addgene #42230) in a 15 ml Falcon tube ...
-
bioRxiv - Molecular Biology 2020Quote: 2 μl RNase-free plasmid DNA (pX330, Addgene #42230, 100 ng/μl),
-
bioRxiv - Neuroscience 2019Quote: ... 125 ng of each DNA construct expressing BFP and ITGB1 (Addgene 51920) and 1.25μl of Lipofectamine LTX was used in each well (in a 24 well plate) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were transfected with 500 ng of LentiCrispR V2 (Addgene plasmid #52961) containing a guide RNA targeting mouse CD81 (GCAACCACAGAGCTACACCT ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 ng of Golden Gate recipient vector (pYPQ143; Addgene, USA; Table 1), 0.5 μl BsaI (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... EZH2 was overexpressed using 100 ng of pCMVHA hEZH2 (Addgene Plasmid #24230) co-transfected with the plasmid of interest.
-
bioRxiv - Microbiology 2023Quote: ... 333 ng of the pMD2.G VSV-G expression vector (Addgene #12259), 200 µL serum-free DMEM ...
-
bioRxiv - Genetics 2022Quote: ... 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449), 80 ng/ul Of-v gRNA described above (see “CRISPR/Cas9 mutagenesis of Of-vermilion”) ...
-
bioRxiv - Cell Biology 2023Quote: ... together with 100 ng of the Renilla luciferase control plasmid (Addgene, 118016). Transfections were performed using a Neon transfection kit (Thermo-Fisher ...
-
bioRxiv - Immunology 2023Quote: ... 250 ng VSV-G (a gift from Didier Trono, Addgene plasmid #12259), and 500 ng lentiviral transfer plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 2400 ng psPAX2 (was a gift from Didier Trono, Addgene #12260), with lipofectamine 2000 for 24h ...
-
bioRxiv - Genomics 2024Quote: ... according to the manufacturers instructions with 200 ng pMD2.G (Addgene #12259), 600 ng psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transfected with 200 ng of pJC6-GL3 (#11979, Addgene; cJUN), which contains the cJUN promoter linked to the firefly luciferase gene ...
-
bioRxiv - Immunology 2023Quote: ... 700 ng/mL of Protein A/G-MNase (plasmid Addgene ID:123461) were added to the immunocomplexes ...
-
bioRxiv - Microbiology 2024Quote: ... 400 ng of the plasmid pCAGIG (a gift from Connie Cepko; Addgene plasmid #11159 ...
-
bioRxiv - Cell Biology 2020Quote: ... Each transfection consisted of 250 ng expression plasmid (pcDNA3-control (Addgene; n/a), pcDNA3-Sox2FLAG (homemad) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Then cells were transfected 500 ng of pDMP-ZsGreen or pEGFP-C1 (Addgene) using Lipofectamine® 2000 Reagent (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and Pmyo-2::mCherry co-injection marker (2.5 ng/μl; pCFJ90, Addgene #19327) were micro-injected in the gonad of young adults ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of plasmid DNA (tdTomato-Lifeact-7, 500 ng/ μL, Addgene, 54528), and 96 μL of PBS ...
-
bioRxiv - Genetics 2022Quote: ... NG-ABE8e (#138491) and pSPgRNA (#47108) plasmids were purchased from Addgene (Watertown, MA). To generate the ABE8e-SpG plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 250 ng envelope plasmid pMD2.G (gift from Didier Trono, Addgene #12259) was prepared to a final volume of 37.5 µL in Opti-MEM ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 100 ng of transposase-expressing helper plasmid (Mates et al. [74] Addgene #34879) was co-transfected with 1000 ng of InterTag or InterCatch ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... or 400 ng/μl Cas9 mRNA (Addgene plasmid #51307 (Guo et al., 2014)) and 200 ng/μl H2B-RFP mRNA (Myers and Krieg ...
-
bioRxiv - Molecular Biology 2021Quote: ... 250 ng of pU6-pegRNA-RFP acceptor (Addgene #132777, courtesy of David Liu), 1 U of BsaI-HFv2 (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... the cells were transiently transfected with 125 ng of GFP-C2Lact (Addgene, #22852) plasmid only or additionally with 125 ng of Lyn11-FRB-mCherry plasmid (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... 600 ng of the lentiviral transfer vector pLenti_CMV-EGFP-2A-mNeonGreen (Addgene # 171599), and 600 ng of various viral envelope plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... the Cas9-expression plasmid pDD162 (Peft-3::Cas9, 50 ng/μL, Addgene #47549) (Dickinson et al. ...
-
bioRxiv - Genetics 2021Quote: ... NG-ABE8e (#138491) and pSPgRNA (#47108) plasmids were purchased from Addgene (Watertown, MA). To generate the ABE8e-SpG plasmid ...
-
bioRxiv - Microbiology 2022Quote: ... together with 600 ng of a plasmid encoding the T7 polymerase (Addgene 65974) using Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... 100,000 HT1-mCdHs were transfected with 900 ng of PE2-encoding plasmid (Addgene #132775), 300 ng of pegRNA-encoding plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... 200,000 HT1-mCdHs were electroporated with 750 ng of ABEmax-encoding plasmid (Addgene, #112095) and 250 ng of sgRNA-encoding plasmid ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50 ng pBS-GGAC-ATGC (51) (Addgene plasmid # 60949; http://n2t.net/addgene:60949; RRID:Addgene_60949), 1.5 μl 10x T4 ligation buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were co-transfected with 750 ng of pCMV-PE2 Plasmid (Addgene Plasmid #132775) and 250 ng of assembled pU6-pegRNA-GG-acceptor using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Genetics 2022Quote: ... HEK- 293T cells were transfected with 100 ng pIS0 (Addgene #12178, encoding firefly luciferase), 100 ng of the Renilla reporter and 800 ng of empty vector (1 µg total plasmid DNA ...