Labshake search
Citations for Addgene :
601 - 650 of 2724 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... S1) targeting the OsNAC5 gene was designed and cloned into the pRGEB31 CRISPR/Cas9 vector (Addgene, Watertown, MA, USA) (Xie and Yang ...
-
bioRxiv - Neuroscience 2024Quote: ... the CaMPARI2 gene (1446 bp) was subcloned from pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40 (Addgene 101060, gift from Eric Schrieter)26 into a lentiviral plasmid (pRT050 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-EF1α::CVS-G (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #67528), AAV-DJ-EF1-DIO-tdTomato (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2435696-24478046) was replaced by the tetracycline resistant gene from the PfoI/EcoRI fragment of pRGD-TcR (Addgene, #74110) (Ledermann et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... The G418 (Geneticin) resistance gene was subcloned from pDEST-CMV-C-eGFP (a gift from Robin Ketteler, Addgene: 122844) and inserted into pLX303-DD-HA-ER-I-PpoI using In-Fusion cloning ...
-
bioRxiv - Cancer Biology 2024Quote: The ABCB-CoChR gene fragments were amplified from CMV-ABCB-CoChR-eYFP and cloned into pcDNA3.0-Magneto2.0-p2A-mCherry (Addgene #74308) backbone vector using the HiFi Assembly Kit ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids pLVX-EF1alpha-SARS-CoV-2-proteins-2xStrep-IRES-Puro proteins are a gift from Nevan Krogan (Addgene)(Gordon ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Genomics 2019Quote: ... we cloned the effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope protein plasmid (pMD2.G, Addgene #12259), REV-expressing plasmid (pRSV-Rev ...
-
bioRxiv - Cell Biology 2021Quote: ... and envelope encoding protein (VSVG; Addgene # 8454). Lentiviral particles were collected after 48 hrs of transfection and were used for transducing target cell lines.
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1 ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... envelope protein-pCMV-VSV-G (Addgene #8454), packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... A plasmid encoding mCherry-tagged FYCO1 was generated by cloning the mCherry-FYCO1 gene from a pBABE-puro-mCherry-FYCO1 plasmid (University of Dundee) into the plasmid backbone of EGFP-LC3B (Addgene) by amplification of fragments using Q5 Hot Start High-Fidelity Master Mix and ligation using a Gibson Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Cell Biology 2020Quote: ... was produced in HEK293T cells that were co-transfected with the vector containing the gene of interest and second generation envelope and packaging plasmids (psPAX–gift from Didier Trono (Addgene plasmid#12260 ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmid was created by adding the rtTA with a 2A peptide to the Puromycin resistance gene in a CMV Puro DEST plasmid (Addgene) by gibson cloning41 ...
-
bioRxiv - Immunology 2021Quote: ... The human full length (HFL) gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537 ...
-
bioRxiv - Genetics 2021Quote: ... For the effector plasmids (pPB_TRE3G::ScFv-GFP-KRAB_EF1a::Neo and pPB_TRE3G::ScFv-GFP-3a3L_EF1a::Neo) the GCN4 specific scFv domain and the sfGFP gene were amplified from PlatTET-gRNA2 plasmid (Addgene #82559) and fused in frame with the human ZNF10 KRAB domain (amplified from the pAAVS1-NDi-CRISPRi (Addgene #73498) ...
-
bioRxiv - Immunology 2021Quote: ... two individual guides per gene were cloned into the LentiCRISPR v2 vector (a gift from Feng Zhang, Addgene plasmid #52961) and the indicated MelJuSo cells were transduced and selected using puromycin ...
-
bioRxiv - Immunology 2019Quote: ... The MPO-mEmerald gene was incorporated into an expression vector by first digesting the mEmerald-MPO-N-18 plasmid (Addgene plasmid #54187 ...
-
bioRxiv - Bioengineering 2019Quote: Genetic engineering of the reporter gene system involved third-generation packaging and envelope-expression plasmids (pMDLg/pRRE, pRSV-Rev, and pMD2.G, Addgene plasmids ...
-
bioRxiv - Neuroscience 2020Quote: ... were produced by the Gene Therapy Center Vector Core at the University of North Carolina at Chapel Hill or by Addgene viral service and had titers of >1012 genome copies per mL ...
-
bioRxiv - Genetics 2020Quote: Prime Editor 2 (PE2) plasmid coding for the SpCas9 gene fused with the MLV reverse transcriptase was obtained from Addgene Inc ...
-
bioRxiv - Genetics 2021Quote: ... K562 cells endogenously expressing BE4 and FNLS were generated by infecting K562 cells with a lentiviral vector carrying a base editor and puromycin resistance genes (pLenti-BE4GamRA-P2A-Puro, Addgene 112673 ...
-
bioRxiv - Cell Biology 2021Quote: ... and immortalized by the viral delivery of telomerase gene using pBABE-neo-hTERT (36) (gift from Bob Weinberg, 1774, Addgene). The virus packaging was performed in HEK293FT cells (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... carrying the cre gene under the hCMV promoter was a kind gift from Brian Sauer (65) (Addgene catalog number : 11916). OFTu cells were plated in a 24-well plate and 24h later transfected with 500 ng of the pBS185-CMV-Cre plasmid using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... The ELO3 coding sequence was deleted using homologous recombination by amplifying the hphMX6 gene conferring hygromycin resistance from the vector pAG32 (Addgene) using the primers elo3F and elo3R (IDT) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Guides targeting p53 CDE+ and CDE− genes were synthesized as pools using array-based synthesis and cloned in the Lentiguide puro vector (Addgene plasmid 52963 – kind gift from Dr ...
-
bioRxiv - Biochemistry 2020Quote: ... and FMRP was purchased as a gene block from IDT. The human sequence (not optimized for E. coli) for FXR1P was purchased from Addgene. The genes coding for the human fragile X proteins (FMRP isoform 1 NCBI Reference Sequence ...
-
bioRxiv - Bioengineering 2020Quote: The pEERM1-PATS vector was created by inserting the synthetic patchoulol synthase gene into the pEERM1 plasmid (Addgene plasmid #64024)4 using HiFi assembly ...
-
bioRxiv - Bioengineering 2020Quote: Synthetic thermal switches were produced as gene blocks by IDT and cloned into the Lego-C backbone (Addgene plasmid #27348). The core promoters were truncated immediately upstream of their previously described TATA boxes at their 5’-termini and at their translational start site on their 3’-termini 76-78 ...
-
bioRxiv - Cell Biology 2021Quote: ... and the other containing the firefly luciferase gene under the control of the Pomc promoter (−646bp to +65bp) (#17553, Addgene). Forty-eight hours after transfection ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1 ...
-
bioRxiv - Cancer Biology 2020Quote: Plasmid pHAGE NFkB-TA-LUC-UBC-GFP-W containing the luciferase gene under the minimal NF-κB promoter was a gift from Darrell Kotton (Addgene plasmid #49343 ...
-
bioRxiv - Cell Biology 2021Quote: ... CHO cell lines were transfected with a reporter construct containing three copies of the PPRE placed upstream of the thymidine kinase promoter-firefly luciferase fusion gene (PPRE X3-TK-luc, Addgene). In addition ...
-
bioRxiv - Cancer Biology 2022Quote: ... a library of 1090 sgRNAs targeting 218 genes on Hsa21 was cloned into the SGL40C.EFS.dTomato vector (Addgene, #69147 and #89395) (Reimer et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... gene fragments were commercially synthesized using Twist Biosciences and ThermoFisher GeneArt and cloned into an AAV vector backbone (Addgene #105922) using restriction enzyme cloning ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The CyPet gene was amplified by PCR from the pCyPet-His vector (pCyPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14030 ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The YPet gene was amplified by PCR from the pYPet-His vector (pYPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14031 ...
-
bioRxiv - Cancer Biology 2022Quote: Single-guide RNAs (sgRNAs) targeting genes of interest were designed and cloned into the pSpCas9(BB)-2A-Puro vector (pX459) V2.0 (Addgene #62988) using Golden Gate Cloning as described [29] ...
-
bioRxiv - Immunology 2020Quote: ... Codon optimized Leucine Zipper CD95 (LZ-CD95L) gene was synthesized by IDT with EcoRI and BamHI sites and cloned into pcDNA3.1(-) (Addgene #104349).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-EGFP, packaged by Addgene) was also infused into OFC in separate groups of animals as a null virus control ...
-
bioRxiv - Synthetic Biology 2022Quote: We generated a plasmid expressing the translationally fused protein TfR-sfGFP-SpyCatcher003-sfCherry1-10 (InterCatch-GFP) by inserting sfCherry1-10 gene sequence from pcDNA3.1(+)_SpyCatcher-6aa-sfCherry1-10 (Feng et al. [53], Addgene #117484) into the TfR-sfGFP-myc tag-SpyCatcher003 plasmid (Keeble et al ...
-
bioRxiv - Cancer Biology 2022Quote: The pFN31K-Nluc-PAK1 vector was constructed as follows: The gene sequence encoding PAK1 from pCMV6M-PAK1 (Plasmid #12209 Addgene) was PCR-amplified using the following oligonucleotide pair ...
-
bioRxiv - Cell Biology 2022Quote: The Spike gene was cleaved from pcDNA-Spike plasmid and cloned into lentiviral vector pLV-mCherry (Addgene, Watertown, MA, USA) with removal of mCherry gene to generate pLV-Spike plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... the polyadenylation terminator was replaced with a shorter one from the bovine growth hormone gene by ligating the EcoRI – RsrII fragment from another EF1a-DIO vector (a gift from Ute Hochgeschwender; Addgene plasmid # ...