Labshake search
Citations for Addgene :
701 - 750 of 2724 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... EGFP-DCTN1 fusion protein (Addgene pEGFP-p150Glued, #36154) or tdTomato-EB3 fusion protein (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: The cDNA encoding human DAT (synthetic gene kindly provided by Dr. Jonathan Javitch, Columbia University, NY, USA61 was inserted into pmEOS2-C1 (RRID: Addgene#54510) to generate pmEOS2-hDAT C1 encoding hDAT with mEOS2 fused to the N-terminus ...
-
bioRxiv - Neuroscience 2021Quote: ... serotype 9 carrying double-floxed fusion genes for hChR2 (E123A) and EYFP under an EF1a promoter (University of Pennsylvania Vector Core, Addgene #35507) were used to transfect PfN neurons ...
-
bioRxiv - Neuroscience 2021Quote: ... We applied our system to the SAD-B19 genome plasmid in which the G gene has been replaced by EGFP (cSPBN-4GFP, Addgene #5248715), targeting the barcode cassette to the 3’ UTR of EGFP adjacent to the viral polyadenylation sequence53 ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... The mCherry-HTT N171 18Q or 89Q were cloned in 3rd generation Lentiviral vector for bi-cistronic expression of EGFP and the gene of interest (Addgene, 24129) and transfected in HEK 293T cells along with packaging plasmids ...
-
bioRxiv - Immunology 2022Quote: Lentiviral particles to generate CRISPR/Cas9-edited cell lines were produced by transfecting 10 cm dishes of HEK293T cells with 1.5 μg of pLentiCRISPRv2 encoding gene specific guide RNAs (Addgene plasmid #52961), 1 μg of p8.91 packaging plasmid(Zufferey et al. ...
-
Redundant and specific roles of cohesin STAG subunits in chromatin looping and transcription controlbioRxiv - Cell Biology 2019Quote: ... A gRNA targeting the 3’ end of the SA1 or SA2 gene in front of the stop codon was cloned into a Cas9 expression construct (Addgene p48193). Both ...
-
bioRxiv - Cancer Biology 2019Quote: ... mCMV promoter and puromycin resistance gene into a previously generated acceptor vector LG-EF1a-Hygro (LentiGuide-Puro vector43 (Addgene plasmid #52963) where U6-sgRNA cassette was removed and the Puro cassette replaced with Hygro) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Retroviral vectors for JMJD6 expression were generated by cloning the Jmjd6 coding sequence with a C-terminal FLAG-tag sequence (11) into the pBABE plasmid vector containing the neomycin resistance gene (Addgene #1767). Mutant versions of JMJD6 were generated from the wild type construct using QuikChange Lightning site-directed mutagenesis kit (Agilent) ...
-
bioRxiv - Developmental Biology 2019Quote: ... p118 PB-TRE-dCas9-VPR 70 containing dCas9 fused to VP64-p65-RTA (dCAS9-VPR) transcriptional activators and hygromycin resistance gene (Addgene, #63800) and a plasmid coding for the PiggyBac transposase (kind gift from Valentina Carlini) ...
-
bioRxiv - Cell Biology 2021Quote: ... which contained: flanking sequences of the YKL075C gene and the KanMX6 coding region from the plasmid pFA6-KanMX6 (Addgene, Watertown MA). All transformations were carried out using the lithium acetate and transformants were identified as colonies that grow on selective solid media ...
-
bioRxiv - Neuroscience 2020Quote: ... targeting exon 3 of the Prnp gene (5′-TCA GTC ATC ATG GCG AAC CT −3′) was cloned into the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene 50946,) to generate pKLV-Prnp sgRNA plasmid ...
-
bioRxiv - Systems Biology 2020Quote: ... was used to clone a pool of four sgRNAs per gene (AGPS, SLC2A11, ZC3H7A, PDCD2L, NPM1, EPS15, hsa-mir-761, RPAP1, SYAP1, TRAF3IP1, and EGFP) into lentiCRISPR v2 (Addgene #52961). iOvCa147 cells were transduced with viral particles encoding a Cas9 and sgRNA expression cassettes ...
-
bioRxiv - Microbiology 2021Quote: ... The SPR tail tube gene was amplified from phage genomic DNA and cloned into the plasmid pBbS8k-RFP (Addgene, cat. #35276) with primers JG249 and JG250 for inducible expression in E ...
-
bioRxiv - Microbiology 2021Quote: An sgRNA (5’-ATCACAACGATCTGTTCGTC-3’) targeting the LGMN gene was cloned into the PX459 plasmid (Addgene plasmid #62988 from Feng Zheng51) encoding Cas9 and puromycin resistance ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μg plasmid/transformation for the gene of interest and 0.5 μg plasmid/transformation of transformation marker (pUbi_GUSplus, Addgene, encoding ß-Glucuronidase) was applied.
-
bioRxiv - Molecular Biology 2020Quote: An sgRNA targeting the MDC1 gene around the ATG translation start site was cloned in pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). The plasmid was then transfected into HEK-293T cells along with a single stranded oligodeoxynucleotide (ssODN ...
-
bioRxiv - Microbiology 2019Quote: ... lentiparticles to generate CRISPR/Cas9-edited cell lines were produced by transfecting 10 cm dishes of HEK293T cells with 1.5 µg of plentiCRISPRv2 encoding gene specific guide RNAs (Addgene plasmid #52961), 1 µg of p8.91 packaging plasmid (Zufferey ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA oligonucleotides coding for guideRNAs against the respective genes (sequences shown in Supplementary Table S1) were cloned into the expression vector LentiCRISPRv2 (Feng Zhang, Addgene #52961).
-
bioRxiv - Cancer Biology 2020Quote: ... A library of 256 CRISPR sgRNA targeting 58 genes was cloned into the CROP-Seq-Guide-Puro expression vector (Addgene #86708) and packaged into lentivirus ...
-
bioRxiv - Biophysics 2020Quote: ... was expressed in E.coli using gene with an N-terminal 6XHis-tag and up stream TEV-protease site cloned into pET28a(+) (Addgene plasmid #2006150). MSP1D1 was purified using IMAC72 with further cleavage of 6xHis-tag by TEV protease (Sigma-Aldrich) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The vector backbones were amplified from plasmids carrying an RK2 origin of replication with a Kanamycin resistance gene for pKSh2 (Addgene #167515) or Gentamicin for pKSh5 (Addgene #149463) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The H2B-miRFP670 fragment was digested with the Cpol (Rsrll) and Klfl enzymes and inserted upstream of the Hygromycin resistance gene cassette of the ES-FUCCI plasmid (Addgene #62451). RAF-ERT2 (Hamilton and Brickman 2014 ...
-
bioRxiv - Neuroscience 2020Quote: Genes encoding FR-GECO1 and FR-GECO1c were amplified by high-fidelity PCR using primers that add vector homologous sequences to the 5’ and 3’ end and assembled into linearized pcDNA3.1/Puro-CAG-ASAP1 to replace the gene encoding for ASAP1 (a gift from Michael Lin, Addgene plasmid #52519)34).
-
bioRxiv - Neuroscience 2020Quote: ... we cloned WT and mutant forms of the TSC1 and MAPT/tau genes in the pLenti-CMV plasmid (Addgene plasmid # 17392) (71) ...
-
bioRxiv - Immunology 2020Quote: ... sgRNAs targeting the endogenous Rosa26 locus or 3’ end sequence of the Wapl gene were cloned by annealing pairs of oligos into pX330 (Addgene, #42230) to construct the pX330_Rosa26 and pX330_Wapl-mAID ...
-
bioRxiv - Neuroscience 2021Quote: ... which was generated by replacing a cassette of a ccdB gene and attR1 and attR2 sites with the coding region of AAV-EF1α-DIO-PSD95.FingR-EGFP-CCR5TC (Addgene #126216)18.
-
bioRxiv - Biophysics 2020Quote: The CbAgo gene was codon harmonized for E.coli Bl21(DE3) and inserted into a pET-His6 MBP TEV cloning vector (Addgene plasmid #29656) using ligation independent cloning ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We co-transformed a high-copy plasmid that contains the Cas9 gene and the guide RNA expression cassette (pML104; Addgene #67638) (Laughery et al ...
-
bioRxiv - Biophysics 2019Quote: The CbAgo gene was codon harmonized for E.coli B121 (DE3) and inserted into a pET-His6 MBP TEV cloning vector (Addgene plasmid # 29656) using ligation independent cloning ...
-
bioRxiv - Molecular Biology 2020Quote: ... The YAP5SA gene was amplified with primers YAP1-5SA-Str-BglII and YAP1-5SA-End-SalI using pQCXIH-Myc-YAP-5SA (Addgene #33093) as a template and ligated into the pAAV-CMV plasmid ...
-
bioRxiv - Biophysics 2019Quote: ... The LRRK2 gene was cloned by using the primer sets: 5’-GCGATAACATGGCTAGTGGCAGC-3’ and 5’-GGGGTTATGCTAGTTACTCAACAGATGTTCGTCTC-3’ with pENTR221-LRRK2 (Addgene #39529) as the template ...
-
bioRxiv - Molecular Biology 2020Quote: The p2T-CAG-spCas9-NeoR mammalian expression plasmid was created by replacing the Blasticidin resistance gene (BlastR) in the p2T-CAG-spCas9-BlastR (Addgene: 107190) 86 with a Neomycin resistance gene (NeoR) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sgRNA targeting the gene body of PHAROH was cloned into a pSpCas9(BB)-2A-GFP vector (PX458, Addgene plasmid #48138) and the sgRNA targeting the upstream promoter region was cloned into a pSpCas9(BB)- 2A-mCherry vector ...
-
bioRxiv - Systems Biology 2019Quote: The HAP1 C12orf49 gene knockout cell line was constructed by first cloning a gRNA targeting C12orf49 (Table S8) into the pX459v2 backbone (Addgene #62988), which was modified to carry the same restriction overhangs as the pLCKO vector (Addgene #73311) ...
-
bioRxiv - Immunology 2021Quote: ... and tandem-dimeric Tomato (tdT) gene was PCR amplified from the pcDNA3.1(+)Luc2=tdT (a gift from Christopher Contag (Addgene plasmid # 32904))(49 ...
-
bioRxiv - Developmental Biology 2020Quote: ... in mouse G4 ES cells the HA-NLS-FlpO-WPRE-Sv40-pA-LoxP-PGK-Neo-polyA-LoxP cassette in frame with the ATG of the endogenous Apln gene (full plasmid sequence and DNA to be deposited at Addgene # reference). All primer sequences required to genotype this mice are provided in Extended Data Table 1.
-
bioRxiv - Cancer Biology 2019Quote: ... a 20-mer sgRNA target sequence (5′-CTCAGAGGGGGCTCGACGCT-3′) at exon 2 of the TP53 gene was designed (28) and cloned into pX330 (Addgene #42230), which was a gift from Dr ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... two gRNAs from a different human gRNA library (AVANA library)118 for each of the 9 genes were cloned into the pLentiCRISPR V2 vector that also expresses Cas9 (Addgene, #52961). Two non-targeting gRNAs were also cloned into the same vector to serve as controls ...
-
bioRxiv - Genetics 2021Quote: ... K562 cells endogenously expressing BE4 and FNLS were generated by infecting K562 cells with a lentiviral vector carrying a base editor and puromycin resistance genes (pLenti-BE4GamRA-P2A-Puro, Addgene 112673; pLenti-FNLS-P2A-Puro, Addgene 110841) [27] ...
-
bioRxiv - Neuroscience 2021Quote: Full-length human APLP1 gene with a Flag tag in the N-terminal was cloned from pCAX APLP1 (Addgene plasmid#30141) and the primers were shown in Key Resources Table (NheI-Flg-hAPLP1-F/XhoI-His-hAPLP1-R) ...
-
bioRxiv - Developmental Biology 2021Quote: gRNA Validation: Two CRISPR/Cas9 guide RNAs targeting the first exon of the SOX17 gene were cloned into pX458 (Addgene 48138) and validated in HEK293T cells (ATCC CRL-3216 ...
-
bioRxiv - Biochemistry 2021Quote: ... 30 base regions of the dnaB gene (S1 Table) targeting the mutation site were inserted into the pCRISPR plasmid (Addgene: 42875) as a guide RNA (gRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... or sgRNAs targeting different regions within the CDC20 gene (sgM1, TCGAACGCGAACTGTGCCAT; sgExon1, CCTGCACTCGCTGCTTCAGC; sgExon3, CCAGGAA-CATCAGAAAGCCT) were cloned into the sgOpti plasmid (puro-resistant, Addgene #85681) and introduced into the inducible CRISPR/Cas9 HeLa cell line by lentiviral transduction 5 ...
-
bioRxiv - Microbiology 2020Quote: ... Two independent sgRNAs per gene were chosen from the Brunello CRISPR knockout library and cloned into the plasmid lentiCRISPR v2 (Addgene #52961) and packaged with plasmids psPAX2 and pMD2.G ...
-
bioRxiv - Genetics 2020Quote: ... the Cbr-unc-119 rescue gene and a portion of the homology arms containing the guide site were removed from pCFJ151(Addgene #19330) (Frøkjær-Jensen et al ...
-
bioRxiv - Microbiology 2021Quote: ... The ZIKV sfRNA sequence and GFP gene fragment were PCR amplified from pUC19-ZIKV-F4 14 and pMYC-GFP (Addgene, #42142) plasmids respectively using primers HindIII_ZIKV_sfRNA and XbaI_GFP (Supplementary table 7 ...
-
bioRxiv - Bioengineering 2022Quote: Lentiviral C→T base-editing reporter plasmid (LV-CS-sg1-GTG-EGFP-Pur) reporter cassette was constructed by amplifying the eGFP gene fragment from pLV-SI-112 (Addgene 131127) using the primer set AA-sg1-BC-CS-eGFP-FW/AA-eGFP-BamHI-RV followed by restriction enzyme digest by EcoRI/BamHI of the eGFP fragment and pLV-SI-112 ...
-
bioRxiv - Bioengineering 2022Quote: ... and the dsRed filler fragment was generated by amplifying a portion of the dsRed gene from CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA (Addgene 55201) with primer set AA-sg1-scaf-short-filler-FW/AA-filler-SpeI-gib-RV in separate PCR reactions ...
-
bioRxiv - Developmental Biology 2022Quote: Guide RNAs were designed to target genes and co-electroporated with pCI-Cas9-Citrine (Addgene #92358. For more detail see (53).