Labshake search
Citations for Addgene :
451 - 500 of 2724 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... the NLS-dCas9-NLS-GFP gene was amplified from plasmid pSLQ1658-dCas9-EGFP (Addgene, plasmid #51023) by PCR and inserted into the BamHI and XhoI restriction sites of the pcDNA5-FRT/TO plasmid (Invitrogen).
-
bioRxiv - Systems Biology 2023Quote: ... The lentiGuide-Blast plasmid was generated by swapping the Blast gene into lentiGuide-Puro (Addgene, #52963). The sgRNA sequences of YAP1 and MTAP ...
-
bioRxiv - Cancer Biology 2022Quote: CD73 gene-editing was generated by electroporation of all-in-one CRISPR/Cas9 vector (px330, Addgene) expressing the 20mer target sequence GCAGCACGTTGGGTTCGGCG (exon1) ...
-
bioRxiv - Molecular Biology 2023Quote: The channelrhodopsin gene from Chloromonas oogama (CoChR) was amplified from pTol1-UAS:CoChR-tdTomato (Addgene Plasmid: 124233) (Antinucci et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... the oligos containing the gene-specific sgRNA target were cloned into the LentiCRISPRv2 Blasticidin (Addgene, #83480). The CRISPR/Cas9 primer sequences were as followed:
-
bioRxiv - Neuroscience 2023Quote: ... was made by replacing the mCre gene in pRVΔGL-4Cre (Chatterjee et al., 2018) (Addgene 98039) with the SAD B19 glycoprotein gene from pCAG-B19G (Chatterjee et al. ...
-
bioRxiv - Immunology 2023Quote: ... The two sgRNAs were cloned into the expression vector px330 carrying the cas9 gene (Addgene 42230), and then the two px330 plasmids with different sgRNAs were mixed equally at a final concentration of 2.5 ng/μL and injected into fertilized eggs of B6D2F1 × B6 by the microinjection technique ...
-
bioRxiv - Biochemistry 2023Quote: ... The human Archease gene spanning residues 27-168 was inserted into the 2M-T (Addgene: 29708) plasmid using ligation-independent cloning (LIC) ...
-
bioRxiv - Microbiology 2023Quote: The eSpCas9(1.1) gene containing two nuclear localization signals (NLS) was obtained from Addgene (Plasmid #71814) and cloned into the pST32 vector ...
-
bioRxiv - Cancer Biology 2023Quote: The IRF4 gene was cloned into pSBtet-GP backbone (Addgene #60495, a gift from Eric. Kowarz) by replacing luciferase gene with IRF4 Human Tagged ORF (Origene #RC204876) ...
-
bioRxiv - Molecular Biology 2023Quote: ... guide RNAs (gRNAs) against each gene were cloned into pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, #62348) modified to express human CD2 or Thy1.1 as cell surface markers ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were transfected with plasmid pLXSN16E6E7 encoding the human papilloma virus HPVE6E7 gene (Addgene #52394) as described [18] ...
-
bioRxiv - Cell Biology 2023Quote: A BSP1 gene was cloned to pCoofy3 vector (a gift from Sabina Suppmann; Addgene plasmid 43983) as described previously (Scholz et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 10 sgRNAs per gene (hCRISPRi-v2; both the “top5” and “supp5” libraries from Addgene #1000000090) were prepared as described in (Palmer et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... each well was transfected with 1.5 µg of the plasmid containing the YFP-Parking gene (Addgene, 23955 ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
bioRxiv - Genetics 2019Quote: ... mCherry fluorescent protein marker (Addgene), and ampicillin resistance gene ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Cancer Biology 2024Quote: ... Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01, Addgene). Mutants of His- ...
-
bioRxiv - Molecular Biology 2020Quote: ... then transfected with lentiviral plasmids encoding the gene of interest and packaging plasmids (Addgene: 12259 and 12260) using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Bioengineering 2019Quote: GV-expressing cells were produced by transforming a pET28a plasmid containing the arg1 gene cluster12 (Addgene #106473) into BL21(A1 ...
-
bioRxiv - Cell Biology 2021Quote: ... GST Tat was generated by cloning pNL4-3 derived tat gene in pGEX-4T1 vector from Addgene. HA Tat and Flag NQO1 were purchased from Addgene ...
-
bioRxiv - Synthetic Biology 2021Quote: ... replacing the GFP gene with the mAID-mCherry cassette derived from pMK292 mAID-mCherry2-NeoR (Addgene #7283033). The bicistronic lentiviral vectors for ROLECCS AS ...
-
bioRxiv - Bioengineering 2020Quote: ... sgRNA targeting TP53 gene exon 5 (5’-GTTGATTCCACACCCCC.GCCcgg-3’) was cloned into lentiGuide-Puro vector (Addgene, #52963), named lentiGuide-Puro_e5.2 ...
-
bioRxiv - Cell Biology 2021Quote: ... a wild copy of the TYR gene was PCR amplified form the pEGFP-TYR plasmid (Addgene, 32781) with NheI and AgeI overhangs ...
-
bioRxiv - Microbiology 2021Quote: ... The gene Fncas12a of Francisella novicida (Zetche et al. 2015) was obtained from plasmid pY001 (Addgene #69973) and amplified with primers cas12a_fwd_BamHI and cas12a_rv_NcoI generating BamHI and NcoI restriction sites for a subsequent restriction cloning to generate pMTL83152::FnCas12a ...
-
bioRxiv - Cell Biology 2020Quote: ... The sgRNA against human TSC2 gene 60 was subcloned into the lentiCRISPR v2 lentiviral vector (Addgene #52961). For lentiviral transduction ...
-
bioRxiv - Microbiology 2022Quote: Hela-H1 cells were transfected with a plasmid encoding the VSV-G gene (pMD2.G; Addgene #12259) using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2021Quote: The selected genes of interest (GOIs) were cloned into the pTet-O-Ngn2-puro plasmid (Addgene #52047) by replacing Ngn2 with the GOI ...
-
bioRxiv - Systems Biology 2020Quote: ... we cloned cDNA for genes of interest into pMXs-gw (Addgene 18656; a gift from Shinya Yamanaka) using BP and LR Clonase II (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2020Quote: We custom-designed a gene-drive vector using the Akbari germline-Cas9 plasmid AAEL010097-Cas9 (Addgene #100707) as a baseline ...
-
bioRxiv - Microbiology 2020Quote: The plasmids used for CRISPR-Cas9 gene editing were pSpCas9(BB)-2A-GFP (PX458, Addgene ID 48138) and pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNAs for Decorin and E-cadherin (Gene ID: 999) were cloned into modified pHA-N1 (#86049, Addgene) and pcDNA3-neo-Strep-flag-Cterm (#102645 ...
-
bioRxiv - Cell Biology 2020Quote: ... pUC19-CAG-GFP was prepared by digesting the GFP gene from the AAVS1-mEGFP (Addgene, plasmid #91565) plasmid by using SdaI and NotI and cloning it into PCR-linearized pUC19 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Gene-specific gRNA-encoding oligonucleotides were cloned into the pSpCas9-gRNA-GFP plasmid (Addgene PX458; no. 48138) targeting the C terminus coding region of the endogenous DHX15 and DHX38 genes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli codon optimized SARS-CoV-2 genes from plasmid vectors synthesized by GinkoBioworks and distributed by Addgene. Amplified genes were digested with NdeI and SacI ...
-
bioRxiv - Systems Biology 2022Quote: sgRNAs targeting along the ORF6 gene were cloned into a mU6-driven guide expression plasmid (Addgene #89359) and delivered via lentiviral transduction at high MOI to the Cas9+ iSLK-BAC16-K8.1pr-mIFP2 cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... A puromycin resistant gene unit was amplified from plasmid pGL3-U6-sgRNA-PGK-puromycin (Addgene, Watertown, MA) by PCR and the 1473 bp product was then inserted in an EcoRV site in intron 19-20 ...
-
bioRxiv - Biophysics 2023Quote: CD28 gene (truncated at R185) was amplified from a commercially available plasmid (pEF6a-CD28-PafA, Addgene, #113400) and inserted into the plasmid pcDNA3.1-ChR2WT-mEos3.2 instead of ChR2 gene using BamHI and NotI restriction sites.
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Genomics 2023Quote: ... CRISPR/Cas9 nickase gene editing was performed using vector pX335-U6-Chimeric BB-CBh-hSpCas9n(D10A) (Addgene) modified by standard restriction enzyme cloning (BbsI ...
-
bioRxiv - Microbiology 2023Quote: ... the DsRed gene was PCR amplifed from the pMSCV-IRES-DsRed Fp vector (Addgene, Watertown, MA, USA) and cloned via HindIII and KpnI into the pBlueScript KS+ vector to generate pBS_DsRed ...
-
bioRxiv - Microbiology 2023Quote: ... The gene coding mScarlet-I was amplified from the plasmid Double UP mNeongreen to mScarlet (Addgene #125134) by PCR using primers P1214 and P1215 and cloned into the EcoRV linearized pHYX137 by IVA in E ...
-
bioRxiv - Neuroscience 2023Quote: ... were made by replacing the CMV promoter and EGFP gene in pCSC-SP-PW-GFP (Addgene 12337) with the leaky tetracycline response element from pAAV-FLEX-hGTB (Addgene 26196 ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting each gene were cloned into the BbsI site of pSpCas9 (BB)–2A–Puro (PX459; Addgene), and cells were transfected with each cloned vector using Lipofectamine™ 3000 Transfection Reagent (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Genes encoding bovine Gβ1 and Gγ2 were derived from the following plasmids: YFP-Gβ1 (Addgene plasmid # 36397) and YFP-Gγ2 (Addgene plasmid # 36102) ...
-
bioRxiv - Neuroscience 2023Quote: ... in the right hemisphere to silence Tsc1 gene and pENN.AAV9.CamKII0.4.eGFP.WPRE.rBG (Addgene viral prep # 105541-AAV9) in the left hemisphere for control conditions ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pKLV2-U6gRNA5(BbsI)-PGKpuro2A73 for delivering sgRNA against specific genes was purchased from Addgene (#67974). Another two plasmids ...