Labshake search
Citations for Addgene :
401 - 450 of 1989 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... LV-TCR plasmids were based on the pRRL backbone derived from pRRLSIN.cPPT.PGK-GFP.WPRE (plasmid #12252, Addgene). The DNA sequences of all plasmids were verified by Sanger sequencing performed by GENEWIZ ...
-
bioRxiv - Developmental Biology 2023Quote: The constructs for epigenome editing were based on the plasmid pSpCas9n(BB)-2A-GFP (Addgene #48140) (Ran et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmid based prime editing: 500 ng pCMV-PE2-GFP (a gift from David Liu, Addgene#132776)115 ...
-
bioRxiv - Neuroscience 2023Quote: ... The self-complementary AAV (scAAV) vectors were based on the scAAV-CAG-GFP vector (Addgene #83279) by replacing the CAG promoter with the hIBA1 promoter ...
-
bioRxiv - Biochemistry 2023Quote: A Halo-based assay to measure mitophagy was recently developed using pSu9-Halo-mGFPplasmid (Addgene, 184905) 53 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...
-
bioRxiv - Cell Biology 2020Quote: ... and pET28a(+) (Addgene #69864-3), for His6-tag protein purification ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: - vector pGEX-4T-3 (Addgene_79149) to express only GST protein for alternative screening.
-
bioRxiv - Systems Biology 2024Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher #11791100) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Biochemistry 2019Quote: ... The PP7 stem loops plasmids are based on the previously published pPOL1 24xPP7sl integrative plasmid19 (Addgene 35196). The stress responsive promoters replace the pPOL1 promoter in the original construct using 1 kbp (800 bp for pSTL1 ...
-
bioRxiv - Molecular Biology 2019Quote: sgRNAs targeting either XACT or T113.3 promoters were designed using the web-based tool CRISPOR (http://crispor.tefor.net/) and cloned into the pLKO5.sgRNA.EFS.tGFP vector (Addgene #57823). Sequences can be found in Table S1 ...
-
bioRxiv - Microbiology 2021Quote: CRISPR-LbCpf1/SpCas9 plasmid was constructed based on the streptomycin-resistant plasmid DS-SPCas (Addgene no. 48645) as described previously21 ...
-
bioRxiv - Cell Biology 2022Quote: ... targeting Rictor were selected using the online tool CHOPCHOP (http://chopchop.cbu.uib.no/) and were cloned into the lentiviral vector pLentiCRISPRv2-LoxPv1 (based on the pLentiCRISPRv2 plasmid from Addgene 5261 with inserted loxP sites flanking the elongation factor 1α short promoter) ...
-
bioRxiv - Cancer Biology 2021Quote: ... CRISPR-cas9-based guide RNA (gRNA) targeting human EED (GATCATAACCAACCATTGTT) was cloned in LentiCRISPR v2 (Addgene 52961), which was mixed with psPAX2 and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: The inducible BCL6 shRNA vectors were generated based on a pLVX-TetOne-Puro vector (RRID: Addgene 124797) according to standard protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentivirus packaging was performed by using MaxPEI-based co-transfection of HEK293T cells with psPAX2 (Addgene #12260), pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: The photoactivation-based fusion assay (Karbowski et al., 2014) was conducted by expressing Mito-PAGFP (Addgene #23348) in primary human fibroblasts ...
-
bioRxiv - Molecular Biology 2023Quote: We designed the following two plasmids based on the pCDH-EF1a-eFFly-mCherry backbone vector (Addgene #104833) with cloning sites BmtI and BamHI ...
-
bioRxiv - Molecular Biology 2020Quote: ... AsCas12a and SpCas9 nucleases were expressed from the pET-based T7 promoter-containing plasmids (Addgene, Plasmids #90095, #62374) in Escherichia coli strain BL21-DE3 as described (3 ...
-
bioRxiv - Genomics 2019Quote: ... The sgRNA expression vector for editing was based on plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene Plasmid # 42230), containing two BpiI restriction sites for inserting guide sequences into the sgRNAs ...
-
bioRxiv - Neuroscience 2021Quote: ... APEX2 sequence was cloned based on pcDNA3-APEX2- NES (a gift from Dr. Alice Ting; Addgene plasmid #4938612). APEX AAVs was packaged into adeno-associated virus serotype 1 by the University of North Carolina (UNC ...
-
bioRxiv - Cell Biology 2021Quote: pKIF1CP176L-GFP and pKIF1CR169W-GFP were based on pKIF1CRIP2-GFP (available from Addgene 130977 (Efimova et al., 2014). R169W was introduced using a mutagenesis PCR with upstream primer UT01 (5’-GGAATTCTGGAGCTATGGCTGGTG-3’) ...
-
bioRxiv - Cell Biology 2021Quote: ... but with a pLKO.1-based vector (gift from Elaine Fuchs, Addgene plasmid # 25999; http://n2t.net/addgene:25999; RRID:Addgene_25999). GFP-H2B transduced cells were sorted by the University of Chicago Cytometry and Antibody Technology Core.
-
bioRxiv - Microbiology 2021Quote: ... we utilized a CRISPR-Cas9 pipeline based on the lentiCRISPR v2 lentivirus construct obtained from Feng Zhang (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2021Quote: ... The homologous templates were constructed based on a pHD-DsRed vector (a gift from Kate O’Connor-Giles; Addgene plasmid #51434 ...
-
bioRxiv - Cancer Biology 2020Quote: cDNAs for human prostate cancer TMPRSS2-ERG fusion was cloned into retroviral-based vector MSCV-C-HA (Addgene). Retrovirus was produced in 293T cells by standard methods using Ampho packaging vector ...
-
bioRxiv - Molecular Biology 2019Quote: Inducible Cas9 (iCas9) BL cells were established by transducing cells with pCW-Cas9-Blast-based lentiviruses (Addgene #83481) and selecting with Blasticidin ...
-
bioRxiv - Neuroscience 2021Quote: ... The homologous templates were constructed based on a pHD-DsRed vector (a gift from Kate O’Connor-Giles; Addgene plasmid #51434 ...
-
bioRxiv - Neuroscience 2022Quote: The CreON knock-in vector (pOC1) is based on pORANGE LOX from (Willems et al., 2020, Addgene #139651), where CAG HA-SpCas9 was removed with XmaJI and NotI and replaced with primers AJ19164 and AJ19165 using primer ligation.
-
bioRxiv - Neuroscience 2020Quote: ... The homology templates were constructed based on a pHD-DsRed vector (a gift from Kate O’Connor-Giles; Addgene plasmid #51434 ...
-
bioRxiv - Molecular Biology 2023Quote: The construct for CRISPR/Cas9 genome editing of Cdr1as splicing sites is based on lentiCRISPRv2 (Addgene plasmid 52961), following the Zhang Lab protocol (39 ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs expressing artificial circRNAs of different sizes are based on the pcDNA3.1(+) Laccase2 MCS Exon Vector (Addgene 69893). We inserted a perfectly matched or seed-mutant site for miR-92a using the NotI and ApaI sites located between the Laccase2 intron and the poly(A ...
-
bioRxiv - Neuroscience 2023Quote: ... The annealed oligos were then ligated into U6 promotor-based cassettes: ipo13b sgRNA1 into pU6a:sgRNA#1 (Addgene #64245), ipo13b sgRNA2 into pU6a:sgRNA#2 (Addgene #64246) ...
-
bioRxiv - Bioengineering 2024Quote: oROS-HT variants were cloned based on the pC1 plasmid backbone from pC1-HyPer-Red (Addgene ID: 48249). Primers for point mutations or fragment assembly required to generate the oROS-HT screening variants were designed for In Vitro Assembly cloning (IVA ...
-
bioRxiv - Neuroscience 2023Quote: Rats were infused bilaterally with AAV encoding the GPCR-activation-based dopamine sensor GRABDA2h (pAAV9-hsyn-GRAB_DA2h, Addgene) or control fluorophore (AAV8-hSYN-GFP) ...
-
bioRxiv - Microbiology 2023Quote: ... The sgRNAs targeting Marchf8 were designed using the web-based software ChopChop (chopchop.cbu.uib.no) (82) and cloned into the lentiCRISPR v2-blast plasmid (Addgene, #83480) using ligating duplex oligonucleotides containing BsmBI restriction sites purchased from Integrated DNA Technologies (IDT ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μg pMD2.G (Addgene #12259), 12 μg pCMV delta R8.2 (Addgene #12263) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-ER-3 (Addgene plasmid #54082), and calnexin-mEmerlad (Addgene plasmid #54021 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μg psPax vector (Addgene #12260), 1.5 μg pMD2.G vector (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFJ104 (Pmyo-3::mCherry, Addgene #19328) and pGH8 (Prab-3::mCherry ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 µg pMD2.G (Addgene #12259) and 9 µg lentiviral vector were diluted in 1.2 mL OptiMEM ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...