Labshake search
Citations for Addgene :
351 - 400 of 1989 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Cell Biology 2019Quote: ... NOX1 and NOX2 deletion constructs were generated by inserting PCR amplified 5’ UTR and 3’ UTR fragments of the target genes sequentially into backbone vector pFGL821 (Addgene #58223, hygromycin resistance), flanking the HPH (hygromycin B phosphotransferase ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Molecular Biology 2019Quote: ... were cloned via BpiI into pX330S-2 and pX330S-3 (Sakuma et al., 2014) and a third vector pGEP179_pX330K (this study) according to kit instructions (Addgene Kit#1000000055, Sakuma et al., 2014). The pGEP179_pX330K plasmid is a modified entry vector generated by cloning the BsaI-pU6-sgRNA-BsaI fragment from pX330A-1×3 (Sakuma et ...
-
bioRxiv - Molecular Biology 2019Quote: All tethering constructs are based on λN-entry or Gal4-entry vectors (submitted to Addgene). Various full-length CDS or CDS variants were inserted into the entry vectors to generate N-terminally tagged fusion proteins ...
-
bioRxiv - Biochemistry 2020Quote: ... Nanobody expression for fluorescence experiments was done on a plasmid based on pAG416GAL-ccdB (Addgene). The plasmid was modified with the Nup120 promoter (500 bp upstream of the ORF ...
-
bioRxiv - Biochemistry 2020Quote: ... Nanobody expression for toxicity experiments was done on a plasmid based on pAG416GAL-ccdB (Addgene). Each VHH sequence was inserted downstream of the GAL promoter and strains were selected and maintained by growth on SC-Ura media.
-
bioRxiv - Cell Biology 2021Quote: ... Gene fragments were ligated into either an mCherry or EGFP pBABE-based vector (Addgene #44432). sgRNA constructs for individual inducible knockout cell lines were generated by primer annealing and ligation into sgOPTI (56 ...
-
bioRxiv - Plant Biology 2021Quote: ... The deletion construct was generated by Gateway BP-based cloning into pDONR1K18MS (Addgene plasmid #726444) and confirmed by digesting the plasmid with the restriction endonuclease BsrGI ...
-
bioRxiv - Cell Biology 2022Quote: ... of two PCR based fragments generated by amplifying the pN-PITCh-GFP (Addgene plasmid #127888) vector backbone using primers 5’ caaacacgtacgcgtacgatgctctagaatg and 5’ tgctatgtaacgcggaactccatatatggg and the Rac1 sequence flanked Puro-GFP cassette from pN-PITCh-GFP using primers 5’ccgcgttacatagcatcgtacgcgtacgtgtttggGGCCCAGCGAGCGGCCCTGAtgaccgagtacaagcccacg and 5’cattctagagcatcgtacgcgtacgtgtttgggACCACACACTTGATGGCCTGCAtcttgtacagctcgtccatgccgag.
-
bioRxiv - Cancer Biology 2022Quote: ... These plasmids are based on all-in-one pSpCas9(BB)-2A-Puro (px459) (Addgene #62988) V2.0 and pSpCas9n(BB)-2A-Puro (px462 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The luciferase-based GO system with sgRNA in the same vector was obtained from Addgene (pLenti-mU6-Luc2GO-PGK-Neo ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids for CRISPR-based knockout were constructed using pMCB320 (Addgene #89359, gift from Michael Bassik) and pMJ179 (Addgene #89556 ...
-
bioRxiv - Genomics 2022Quote: ... and cloned into a lentivirus-based sgRNA vector tagged with GFP (Addgene plasmid no. 65656). Cas9-expressing T-ALL cell lines were transduced with sgRNA library virus at a low MOI (∼0.3) ...
-
bioRxiv - Neuroscience 2023Quote: ... We injected AAV5.EF1.dflox.hChR2(H134R)- mCherry.WPRE.hGH (based on Addgene plasmid #20297, UNC Vector Core) cre- dependent virus into the frontal cortex ...
-
bioRxiv - Genetics 2023Quote: ... AAV-F60,86 is an engineered AAV9-based capsid in pAR9 (rep/cap) (Addgene plasmid 166921). AAV production was performed as previously described60 ...
-
bioRxiv - Genetics 2023Quote: ... and the NLS-Gal4AD domain from a plasmid originally based on pActL-Gal4AD (Addgene 15303) and the 127D01 tag was inserted as part of the primer ...
-
ER mediates spatial regulation of lysosome-endosome interactions via motion switch at junction sitesbioRxiv - Cell Biology 2023Quote: ... The shRNA plasmids were constructed based on the lentiviral backbone PLKO.1 (Addgene Cat# 8453) following the protocol provided by Addgene (https://www.addgene.org/protocols/) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids employed for the CRISPR experiments were generated based on the pML104 backbone (Addgene #67638). The pBY011 plasmid encoding yeast CHD1 gene was purchased from the DNASU plasmid repository (clone ID ...
-
bioRxiv - Microbiology 2023Quote: The plasmid-based VSV reverse genetic system (pVSV eGFP dG) was obtained from Addgene (#31842) and modified to insert the wild-type S gene of the original Wuhan-Hu-1 strain of SARS-CoV-2 (GenBank MN908947.3 ...
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Biochemistry 2023Quote: ... MEFs were split into 6 well plates to ∼80% confluence and transfected with 2 µg SV40 1: pBSSVD2005 (a gift from David Ron; Addgene plasmid #21826) using FuGENE HD according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... we designed and generated a CRISPR plasmid targeting the 5′– GTTTGCCCATTACTCTT/CAT(PAM:AGG)–3′ sequence using pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42260, gift from Dr. Feng Zhang), according to a published protocol (Ran et al ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... NG-ABEmax-encoding plasmid wasconstructed in our lab based on the appropriate backbone plasmids (Addgene # 112095).
-
bioRxiv - Molecular Biology 2021Quote: ... and also cloned spCas9nuclease with Chd4 sgRNA based on PX458-pSpCas9(BB)-2A-GFP (#48138, Addgene). Then ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Rosa26a donor vector was based on pROSA26-PA (a gift from Frank Costantini, Addgene #21271). The mCherry expression cassette from pCAGGS-mCherry (a gift from Phil Sharp ...
-
bioRxiv - Bioengineering 2021Quote: ... with pRRL-based transfer plasmids as well as pMD2.G (Adgene # 12259) and psPAX2 (Addgene # 12260) using Lipofectamine 2000 (Thermo ...
-
bioRxiv - Cell Biology 2020Quote: ... The HA-Dre DNA tile was designed based on pCAG-NLS-HA-Dre (Addgene Plasmid #51272).32 The CAG promoter was subcloned from pSF-CAG-Kan (OG505 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2-CaMII2a-4mtsGCaMP8m was based on the plasmid on pAAV-CaMKIIa-GCaMP6s-p2A-nls_dTomato (Addgene #51086). Kozak-4MTS fragment was synthesized by GenScript and cloned into the intermediate plasmid-AAV2-hSyn-linker-jGCaMP8m ...
-
bioRxiv - Cell Biology 2022Quote: 2xMS2 was designed based on the MS2 sequence as reported by the Singer Lab (Addgene #27118). The sequence of 2xMS2 was as follows ...