Labshake search
Citations for Addgene :
301 - 350 of 1989 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... the gRNA oligonucleotides against murine mesothelin (5’- ATGTGGATGTACTCCCACGG-3’) (synthesized by Dr. Genewiz, MA, USA) were cloned into lentiCRISPRv2 hygro vector (Addgene# 98291) as previously reported55 ...
-
bioRxiv - Neuroscience 2024Quote: ... The protein-coding sequence was codon optimized and flanked by HindIII (5’) and NotI (3’) restriction sites for cloning into a pCMV plasmid (Addgene #60360). A hemagglutinin (HA ...
-
bioRxiv - Genetics 2020Quote: ... we used a codon-optimized yEGFP based on sequence from plasmid pKT0127 (Addgene plasmid #8728 ...
-
bioRxiv - Microbiology 2020Quote: Plasmids encoding Cas9 and guide RNAs were based on pX458 (Addgene plasmid 48138) (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2022Quote: Lentiviruses were generated by transfection of pINDUCER20-based vectors (Addgene, plasmid no. 44012) for Dox-inducible expression of lnc152 ...
-
bioRxiv - Genomics 2023Quote: ... Based on the original lentiviral backbone plasmid (pHAGE-Luc2-IRES-ZsGreen, Addgene 164432), we replaced the Luc2-IRES-ZsGreen reporter with a cassette encoding H2B fused to Nanoluciferase (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... based on an AAVS1 SA-2A-puro-pA donor (plasmid no. 22075; Addgene), was generated by replacing the puromycin resistance gene with the neomycin resistance gene and cloning a cassette containing the Tet-On 3G promoter driving the human NGN2 complementary DNA followed by P2A ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AAAGTGGGACGCGGCACCTA-3’ from Zhang lab database) was cloned as synthetic dsDNA into lentiCRISPRv2 vector (provided by F. Zhang, Addgene plasmid #52961) as described (Sanjana et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloning to insert SOX9 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP plasmid (a gift from Janet Rossant, Addgene plasmid # 112851). AAVS1 repair template was created by Infusion cloning to swap the CAG promoter and Puromycin resistance cassette in plasmid AICSDP-42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesized IRIS guide RNA oligonucleotide (target sequence: 5’-CTGGGGCAAACACAAAAACCTGG-3’) was cloned into the BsmB1 sites of the lentiCRISPRv2 vector (a gift from Feng Zhang, Addgene plasmid #52961)50 following the protocol described by Sanjana et al.50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Injection mix consisted of 0.5pmol/ul in vitro transcribed RNA and 2.5ng/ul co-injection marker (pmyo-2::mCherry::unc-54 3’UTR) plasmid pCFJ90 (Addgene, plasmid #19327), dissolved in water ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Developmental Biology 2023Quote: Two gRNAs were designed to target the exon 3 of REV1 (Supplementary Table 2) and subcloned into the PX458 plasmid (Addgene, 48138). 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs of the human proteins were cloned into pTT5 based expression vectors (Addgene #52355). The constructs were tagged with Twin-Strep-tag (SII ...
-
bioRxiv - Biophysics 2019Quote: The backbones of all AAV plasmids were based on pAAV-EF1a-Cre (Addgene, 55636) with poly(A ...
-
bioRxiv - Developmental Biology 2019Quote: ... The final Tol2-based construct was assembled into the pTol2Dest(R1R2) (Addgene plasmid # 73484)44 using Gateway 3-fragment recombination with pE(L1L4)Cerulean-H2B in the first position ...
-
bioRxiv - Biophysics 2021Quote: ... The dCas9 open reading frame used in all dCas9-based constructs originates from Addgene plasmid #60910 ...
-
bioRxiv - Neuroscience 2021Quote: ... Lentivirus encoding GFP or TTL cDNA (packaging vectors, pWPT-based vector, Addgene, Cambridge, MA) and shTTL1 ...
-
bioRxiv - Neuroscience 2020Quote: The backbone of CS constructs was based on pAAV-EF1α-DO-mCherry (Addgene, #37119)27 ...
-
bioRxiv - Molecular Biology 2020Quote: ... using co-expression of a pericam-based ATP biosensor (Perceval HR; Addgene ID: 49083) and pHRed ...
-
bioRxiv - Cell Biology 2022Quote: Cas9-expressing J774 cells were transduced with lentivirus based on pMCB320 (Addgene plasmid #89359) with mCherry replaced by BFP and containing the sgRNA sequences given in the table below ...
-
bioRxiv - Cell Biology 2022Quote: ... GCaMP6s-GTU construct was made based on mCherry-γ-Tubulin-17 backbone (Addgene #55050). GCaMP6s constructs were stably expressed in C2C12 cells to perform Ca2+ imaging ...
-
bioRxiv - Neuroscience 2022Quote: Lentiviral vectors were based on FUGW (FUGW was a gift from David Baltimore [Addgene plasmid # 14883 ...
-
ER mediates spatial regulation of lysosome-endosome interactions via motion switch at junction sitesbioRxiv - Cell Biology 2023Quote: ... The sgRNA plasmids were constructed based on the lentiviral backbone LentiCRISPRv2 (Addgene Cat# 52961) following previously described protocol34 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLenti-PGK-Neo-PIP-FUCCI (Fluorescent Ubiquitination-based Cell Cycle Indicator) (Addgene # 118616) was used for accurate cell cycle phase indicator [34] ...
-
bioRxiv - Genomics 2023Quote: Lentiviral vectors were based on the pRRLSIN.cPPT.PGK-GFP.WPRE (kindly gifted from Didier Trono; Addgene plasmid # 12252 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a pcDNA3.1-based plasmid containing a C-terminal 3xFLAG-V5 tag (Addgene 87063) for all other variants ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR-based knockout cell lines were generated using the lentiCRISPRv2 vector obtained from Addgene, which expresses a single guide RNA ...
-
bioRxiv - Neuroscience 2019Quote: ... 5.2×1012 gc/ml) and AAV2/5-hSyn-DIO-hM3Dq-mCherry (7.8×1012 gc/ml) were produced from Addgene plasmids #44362 and #44361 at the facility of Nantes University (UMR 1089 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 x 105 HeLa cells were seeded into a 6-well plate and next day transfected with 2 μg of the FLPe recombinase plasmid (Addgene #20733) (Beard et al. ...
-
bioRxiv - Systems Biology 2019Quote: ... 350k HAP1 WT cells were seeded into a 6-well plate and 24 hours later cells were transfected with a mix of 2 µg pX459 plasmid (Addgene #62988) carrying a gRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...