Labshake search
Citations for Addgene :
401 - 450 of 1157 citations for Rat Phosphatidic Acid Phosphatase Type 2A PPAP2A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Appropriate guide RNAs were separately cloned into the SpCas9(BB)-2A-GFP (PX458) vector (Addgene, 48138) or pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... the plasmid pSpCas9(BB)-2A-GFP (PX458) (PX458 was a gift from Feng Zhang, Addgene #48138) in which a sgRNA targeting either an intergenic region of chromosome 8 (Ctrl ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Genetics 2022Quote: ... Complementary gRNA oligonucleotides were cloned into pSpCas9(BB)-2A-Puro plasmid (pX459; Addgene plasmid ID# 48139) using the BbsI I site ...
-
bioRxiv - Molecular Biology 2020Quote: ... NLS-Cas13d-NLS-HA-T2A-GFP was amplified from pXR001: EF1a-CasRx-2A-EGFP (Addgene #109049) and recombined into pCR8-TOPO and then further recombined into pMK33-GW to generate pMK33/NLS-Cas13d-NLS-HA-T2A-GFP ...
-
bioRxiv - Cancer Biology 2019Quote: ... The sgRNAs were cloned into the pX459 (pSpCas9 (BB)-2A-Puro) plasmid vector (Addgene, Cat#62988). Mouse or human cell lines were transfected with the abovementioned plasmids using Lipofectamine 3000 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by PCR amplification and insertion of 2A-PuroR (a gift from Brett Stringer; Addgene 98290) and TagBFP ...
-
bioRxiv - Cell Biology 2021Quote: ... Single CYRI CRISPR A-673 was generated using Lentiviral CRISPR vector (hSpCas9-2A-Puro, Addgene #62988) and selected using 1μg/ml Puromycin (Invivogen ...
-
bioRxiv - Cell Biology 2019Quote: ... CSB or XPA gene together with an expression vector encoding Cas9-2A-GFP (pX458; Addgene #48138) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into the BbsI site of pSpCas9(BB)-2A-GFP (pX458; Addgene, Cambridge, MA, USA). PX 458 was a gift from Feng Zhang (Addgene plasmid # 48138 ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: ... the cells were transduced by EF1a-CasRx (no NLS-RfxCas13d)-2A-EGFP (modified from Addgene #109049) lentivirus ...
-
bioRxiv - Molecular Biology 2022Quote: The RfxCas13d-GFP cassette was amplified from the plasmid pXR001:EF1a-CasRx-2A-EGFP (Addgene #109049) using the primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA oligos (GTAACGGCAGACTTCTCCTC) were ligated into the pSpCas9(BB)-2A-GFP (px458) vector (48138; Addgene). BEL-A cells (1.0 × 106 ...
-
bioRxiv - Cell Biology 2022Quote: ... GTCGTCGGCCCGCTTCCGGAAGG for RnArpC5 and GATCCACTCGGCGGAAGCGTGAGG for RnArpC5Lwere cloned into pSpCas9(BB)-2A-Puro (Addgene, ID 48139). Cells were transfected employing Lipofectamine™ LTX Reagent with PLUS™ Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid #6298832), pU6-sgGFP-NT1 was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid #46914 ...
-
bioRxiv - Cell Biology 2023Quote: ... gRNAs were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (gift from. Feng Zhang, Addgene #62988) using BbsI sites and confirmed by Sanger sequencing.
-
bioRxiv - Microbiology 2023Quote: ... and an ISG54 promoter driving Nluc-2A-GFP cloned into the pSBbi-BB backbone (Addgene 60521).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were co-transfected with two gRNAs and pSpCas9n(BB)-2A-Puro (PX462) V2.0 (Addgene, 62987). After 24 h the cells were selected with puromycin and expanded ...
-
bioRxiv - Developmental Biology 2023Quote: The constructs for epigenome editing were based on the plasmid pSpCas9n(BB)-2A-GFP (Addgene #48140) (Ran et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... sabaeus genome and cloned into pSpCas9(BB)-2A-Puro (a gift from Feng Zhang, Addgene # 62988) following the protocol in [68] ...
-
bioRxiv - Cancer Biology 2023Quote: ... obtained from Sigma were cloned into the pSpCas9(BB)-2A-GFP bacterial plasmid sourced from Addgene (PX458; RRID: Addgene_48138) following the protocol as defined by the Zhang lab [19] and sequenced for correct oligonucleotide insertion ...
-
bioRxiv - Genomics 2023Quote: ... guide RNAs (gRNAs) (Table S5) were cloned into pSpCas9(BB)-2A-Puro (pCas9-Puro, Addgene 62988) using BbsI Golden Gate reactions as described (Ran et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNA was then cloned into a pSpCas9(BB)-2A-puro V2.0 (PX459) plasmid (Addgene #62988). The vector was used for organoid transfection using Lipofectamine® 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... Both guide sequences were then cloned as DNA inserts into pSpCas9 (BB)-2A-GFP (pX458) (Addgene plasmid ...
-
bioRxiv - Systems Biology 2023Quote: ... Three guides were ordered from Eurofins genomics and cloned into pSpCas9(BB)-2A-Puro (Addgene #48139) plasmids using a one-step restriction-ligation protocol (85) ...
-
bioRxiv - Genomics 2023Quote: Cas9 and the sgRNA were expressed from the pSpCas9(BB)-2A-GFP (PX458) plasmid from Addgene [72 ...
-
bioRxiv - Neuroscience 2023Quote: ... and eGFP were subcloned from AAV-hSyn-FLEX-TVA-P2A-EGFP-2A-oG (Addgene, Cat# 85225). AAVs were diluted 1:5 in 1x PBS immediately prior to use ...
-
bioRxiv - Biophysics 2023Quote: ... coli expression vectors encoding either no tag (UC Berkeley Macrolab vector 2A-T, Addgene ID 29665) or an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T ...
-
bioRxiv - Cell Biology 2023Quote: ... one of the gRNAs was cloned into SpCas9(BB)-2A-GFP (px458) plasmid (Addgene; Cat #48138), and the other gRNA was cloned into the px330-mCherry plasmid (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Genetics 2024Quote: ... Plasmid pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPRE was a gift from Aviv Regev (Addgene plasmid # 85452 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA spacers were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene, cat. #62988) as described previously 89 ...
-
bioRxiv - Cell Biology 2024Quote: ... the sgRNA spacers were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene #62988) as described previously (Ran et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... [34] for endogenous tagging and BbsI sites forpSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene 62988), for ATG14 knockouts ...
-
bioRxiv - Cell Biology 2024Quote: ... The pX459-sfCherry CRISPR-Cas9 vector were generated from pSpCas9(BB)-2A-Puro (pX459) V2.0 (Addgene plasmid # 62988 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179 ...
-
bioRxiv - Biophysics 2023Quote: ... The lambda Phosphatase plasmid was obtained from Addgene (a gift from John Chodera & Nicholas Levinson & Markus Seeliger ...
-
bioRxiv - Cell Biology 2023Quote: ... rat OTC (from Addgene plasmid #71877) was cloned into the lentiviral backbone pLV-EF1a-IRES-Hygro (Addgene plasmid #85134) ...
-
bioRxiv - Developmental Biology 2021Quote: ... All gRNAs were synthesized as oligonucleotides and cloned into the pSpCas9(BB)-2A-GFP plasmid (px458, Addgene) following the protocol of Ran et al(23) ...
-
bioRxiv - Developmental Biology 2020Quote: ... was seeded on MEF then transfected with two designed pSpCas9(BB)-2A-Puro (pX459) V2.0 (Addgene #62988) plasmids using Lipofectamine 3000 (Thermofisher) ...
-
bioRxiv - Cell Biology 2019Quote: ... the targeting sequence for LC3B (TTCTCCGACGGCATGGTGCA) was cloned into the pSpCas9 (BB)-2A-GFP plasmid (Addgene, 48138). Donor DNA for homology recombination consisted of a 1000-bp left homology arm ...
-
bioRxiv - Developmental Biology 2020Quote: ... sgRNAs were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Feng Zhang Lab; Addgene plasmid #62988; http://n2t.net/addgene:62988; RRID:Addgene_62988) according to the Zhang Lab General Cloning Protocol (Ran et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Guide RNAs (gRNAs) were cloned into a CRISPR/Cas9 plasmid hSpCas9(BB)-2A-GFP (PX458; Addgene #48138)63 ...
-
bioRxiv - Genomics 2021Quote: ... Guide RNAs TGCGACATAGTAGGGATAAC (gRNA1) and GCATTATCCACATTCATGTG (gRNA2) were cloned into plasmid pSpCas9(BB)-2A-GFP (Addgene #48138) by the company VectorBuilder and shipped as pRP[CRISPR]-EGFP-hCas9-U6> {VP_gRNA1} and pRP[CRISPR]-EGFP-hCas9-U6> {VP_gRNA2} ...
-
bioRxiv - Immunology 2021Quote: ... The knock out was performed by transfection of the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene, USA), expressing a sgRNA (Ckap4 ...
-
bioRxiv - Neuroscience 2021Quote: ... we linearized the pSpCas9(BB)-2A-Puro (PX459) plasmid (a gift from Feng Zhang; Addgene plasmid # 48139) with BbsI and dephosphorylated it with calf intestinal alkaline phosphatase ...
-
bioRxiv - Cell Biology 2021Quote: Complimentary oligos were annealed and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene plasmid #62988) at the BbsI sites ...