Labshake search
Citations for Addgene :
601 - 650 of 1157 citations for Rat Phosphatidic Acid Phosphatase Type 2A PPAP2A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... for generation of isogenic control lines were designed using an online tool (crispr.mit.edu) and ordered as oligos to be cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, MA, USA).
-
bioRxiv - Developmental Biology 2023Quote: A short guide RNA (sgRNA) sequence (GCTGCTGGTGTGCCCCGGGCTGG) was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) as outlined in 49 ...
-
bioRxiv - Biochemistry 2022Quote: ... and sgRNA oligos synthesized from IDT were annealed and cloned into pSpCas9(BB)-2A-Puro (PX459)-V2.0 (Addgene; 62988). Homology arms for the donor vector were amplified via PCR from digested DNA fragments of genomic DNA purified from mES cells and cloned into a premade pUC19-HT vector ...
-
bioRxiv - Biophysics 2023Quote: ... several gRNAs were designed in the downstream region of Klf4 and cloned into pspCas9-2A-puro (PX459, Addgene 62988). Before the day of transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... 101000053) according to the manufacturer’s instructions with pSpCas9(BB)-2A-GFP (PX458) plasmid (a gift from Feng Zhang; Addgene plasmid #48138 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 17 as a template and inserted into pXR002: EF1a-dCasRx-2A-EGFP (a gift from Patrick Hsu; Addgene plasmid #109050; http://n2t.net/addgene:109050; RRID: Addgene_109050) 19 between the C-terminal and N-terminal NLSs in the plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... a guide sequence targeting exon 4 and 5 was cloned in the pSpCas9(BB)-2A-Puro construct (Addgene 48139). For βTC3 cells ...
-
bioRxiv - Bioengineering 2023Quote: T-2A-EGFP-PGK-Puro was a gift from James Thomson (Addgene plasmid # 83344; http://n2t.net/addgene:83344; RRID: Addgene_83344). T-2A-H2B-tdTomato was generated by replacing the EGFP fragment with H2B-tdTomato using the In-Fusion® HD Cloning Kit (Catalog #639648 ...
-
bioRxiv - Microbiology 2023Quote: ... USA) and cloned into the pSpCas9(BB)-2A-GFP (PX458) plasmid which was a gift from Feng Zhang (Addgene plasmid #48138 ...
-
bioRxiv - Cell Biology 2023Quote: Previously reported and validated sgRNA targeting exon-10 of G6PD was used to clone into the pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPRE vector (Addgene #85452). This particular gRNA was transfected using lipofectamine 3000 (Invitrogen #L3000001 ...
-
bioRxiv - Cell Biology 2023Quote: ... and were cloned into pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138; http://n2t.net/addgene:48138; RRID: Addgene_48138) containing pSpCas9 and an eGFP reporter cassette ...
-
bioRxiv - Cell Biology 2023Quote: ... gRNAs were sub-cloned into vector pSpCas9(BB)-2A-Puro (PX459) (Addgene, 48139, deposited by the F. Zhang lab), and gRNA plasmids for targeting PRKAA1 and PRKAA2 were co-transfected into cells with TransIT-LT1 (Mirus ...
-
bioRxiv - Cancer Biology 2023Quote: ... The CD19-CAR-28z-2A-EGFP gene cassette from pSLCAR-CD19-28z (a gift from Scott McComb: Addgene 135991)53 was cloned into the MTOR donor vector by Gibson assembly without the 3xFLAG ...
-
bioRxiv - Cell Biology 2023Quote: ... were ordered from Sigma Aldrich as oligonucleotides (Table 2) and were cloned into pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138 ...
-
bioRxiv - Cell Biology 2023Quote: ... targeting AP4M1 were designed using CHOPCHOP (https://chopchop.cbu.uib.no/) and cloned into pSpCas9(BB)-2A-GFP (pX-458) vector (Addgene plasmid #48138) at the BbSI restriction site as described (Ran ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... Parental HEK293 cells were co-transfected with 1.0 µg each of PBKS-Cas9-2A-eGFP plasmid (Addgene plasmid #68371) and plasmid encoding for gRNA ...
-
bioRxiv - Biochemistry 2023Quote: ... coli with lambda phosphatase spectinomycin-resistant plasmid (Addgene plasmid #79748). We used either wild-type ...
-
bioRxiv - Cell Biology 2023Quote: ... AP2µ2(rat)-mCherry was obtained from Addgene (#27672).
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cancer Biology 2021Quote: The expression vector pspCas9(BB)-2A-Puro (PX459) used for UPP1 CRISPR/Cas9 construct was obtained from Addgene (Plasmid #48139). The plasmid was cut using the restriction enzyme BbsI followed by the insertion of UPP1 sgRNAs (Table 2 ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmid was created by adding the rtTA with a 2A peptide to the Puromycin resistance gene in a CMV Puro DEST plasmid (Addgene) by gibson cloning41 ...
-
bioRxiv - Cell Biology 2020Quote: ... designed by Life technologies to target the second exon of murine Vangl2 (gRNA: 5’-TCGGCTATTCCTACAAGTC-3’) into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138). Upon transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... gIL6 was cloned into the all-in-one plasmid hU6-DR_BsmBI-EFS-RfxCas13d-NLS-2A-Puro-WPRE (Addgene #138147, ref18). DsRed plasmid was modified from pLenti-DsRed_IRES_EGFP (Addgene #92194 ...
-
bioRxiv - Developmental Biology 2022Quote: Oligo DNAs of the target sequence were ligated into the BbsI site of the pSpCas9(BB)-2A-Puro (pX459) V2.0 plasmids (Addgene #62988). The combination of #1 and #2 or #3 and #4 oligos was used to establish Fgf10-KO ESCs ...
-
bioRxiv - Genomics 2020Quote: ... CRISPR editing was performed as described previously2 using Cas9 plasmids pSpCas9(BB)-2A-Puro (PX459) V2.0 (a gift from F. Zhang, Addgene 62988) or pCas9_GFP (a gift from K ...
-
bioRxiv - Genomics 2020Quote: ... and the T2A-NeoR was amplified from pAC95-pmax-dCas9VP160-2A-neo58 (a gift from Rudolf Jaenisch, Addgene plasmid #48227). The sequence for the 5GA linker was included in one of the primers ...
-
bioRxiv - Genomics 2020Quote: ... the parental cell line was transduced at an MOI of ∼0.5 with lentivirus generated using the Lenti Cas9-2A-Blast plasmid (kind gift of the Moffat lab, Addgene #73310) and selected with 20 µg/ml blasticidin (InvivoGen ...
-
bioRxiv - Cell Biology 2019Quote: ... DDRGK1 and UFL1 knockout cell lines were generated by transient transfection of two pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) plasmids carrying sgRNAs that each target the downstream and upstream regions of the transcription start site ...
-
bioRxiv - Neuroscience 2019Quote: ... The original CBh promoter in pSpCas9(BB)-2A-GFP plasmid was then replaced with the CAGGs promoter from pCAGGs–mCherry (#41583, Addgene). The obtained pCAGGs-Cas9(BB)-2A-GFP-gRNA plasmid was subsequently used for the in vitro experiments ...
-
bioRxiv - Neuroscience 2019Quote: ... The oligonucleotides to generate the gRNAs (Integrated DNA Technologies) were annealed in vitro and cloned in the BbsI sites of the pSpCas9(BB)-2A-GFP plasmid (#48138, Addgene). The original CBh promoter in pSpCas9(BB)-2A-GFP plasmid was then replaced with the CAGGs promoter from pCAGGs–mCherry (#41583 ...
-
bioRxiv - Genomics 2019Quote: ... A 20bp guide (GGGAGACAGAGCTTTCGACA-129S1 or GGAGACACAGCTTTCGACA-WSB) was cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). 2×106 cells seeded on a 60mm dish were co-transfected with equimolar amounts (2.5ug each ...
-
bioRxiv - Genomics 2019Quote: ... A guide targeting the last coding exon of Nanog (CCACTTTATACTCTGAATGC) was cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). 5×105 cells seeded on a 12-well plate were co-transfected with equimolar amounts (0.5ug each ...
-
bioRxiv - Genetics 2020Quote: ... pX458 (pSpCas9(BB)-2A-GFP) was a gift from Feng Zhang (Broad Institute) and is available from Addgene (plasmid #48138). HUDEP-2 cells were then transfected as previously described55 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Two complementary oligonucleotides were annealed and cloned into BbsI site of pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988) for co-expression with Cas9 using 5U of T4 DNA ligase ...
-
bioRxiv - Cell Biology 2021Quote: ... The HeLa GFP-RAB7 line was generated by transfecting HeLa cells (ATCC) with the donor plasmid pDONOR-GFP-RAB7 and pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, #62988) bearing the appropriate targeting sequence (5’-TAGTTTGAAGGATGACCTCT-3’ ...
-
bioRxiv - Cell Biology 2020Quote: HeLa knockout lines were generated using the CRISPR/Cas9 method (Ran et al., 2013) by transfecting pSpCas9-2A-Puro (Addgene) vectors containing the following targeting sequences for gRNAs:
-
bioRxiv - Cell Biology 2021Quote: ... For CRISPR Cas9 KO generation two gRNA directed to exon 4 and exon 5 (Table M1) were cloned in pSpCas9 (BB)-2A-Puro V2.0 (Addgene #62988).
-
bioRxiv - Molecular Biology 2021Quote: ... The FLAG-YTHDC1 sequence was amplified then cloned downstream of dCasRX at NheI in the pXR002 plasmid (pXR002: EF1a-dCasRx-2A-EGFP was a gift from Patrick Hsu (Addgene plasmid # 109050 ...
-
bioRxiv - Cancer Biology 2020Quote: Single-cell clones of Cas9-expressing CALM-AF10 cells were established by cloning in a Lenti-Cas9-2A-Blast vector (Addgene: #73310 ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA (sgRNA) targeting exon 4 of TP53 (5’-CTGTCATCTTCTGTCCCTTC-3’) was cloned into pSpCas9(BB)-2A-GFP (pX458, plasmid #48138, Addgene). pSpCas9(BB)-2A-GFP was a kind gift from dr ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs expressing Cas9 and either gRNA were generated by cloning into pSpCas9(BB)-2A-Puro (PX459) vectors (Addgene plasmid #48139). Individual vectors were transfected into U2OS cells using TransIT-LT1 reagent (Mirus ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments of 5’ and 3’ homology arms of ORACLE-OCT4 (exo) were replaced using human OCT4-2a-eGFP-PGK-Puro (#31938, Addgene) to target endogenous OCT4 locus with modification ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified and cloned red shifted Luc gene downstream of MNDU3 promoter and linked via 2A peptide to florescent protein encoding gene which were amplified from Addgene plasmids 48249 (mWasabi) ...
-
bioRxiv - Cancer Biology 2022Quote: Single-guide RNAs (sgRNAs) targeting genes of interest were designed and cloned into the pSpCas9(BB)-2A-Puro vector (pX459) V2.0 (Addgene #62988) using Golden Gate Cloning as described [29] ...
-
β-catenin signaling via astrocyte-encoded TCF7L2 regulates neuronal excitability and social behaviorbioRxiv - Neuroscience 2020Quote: pAAV:ITR-U6-sgRNA-gfaABC1D-Cre transfer plasmid was constructed on a backbone of AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR (Addgene #60231) (Platt et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... sgRNAs were designed using the CRISPOR online tool (Haeussler et al., 2016) and cloned into pSptCas9(BB)-2A-Puro(PX459)-V2.0 (Addgene #62988) as previously described (Ran et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... sgRNAs in Table S1 were cloned in pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138) and transfected into mESCs ...