Labshake search
Citations for Addgene :
301 - 350 of 3258 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence targeting NRF2 (5’-TATTTGACTTCAGTCAGCGA-3’) was cloned into the lentiCRISPR v2 vector (Addgene #52961). Lentiviral packaging was performed by co-transfecting the resulting plasmid with psPAX2 (Addgene 12260 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... pGEM4Z-T7-5’UTR-EGFP-3’UTR-A64 was a gift from Christopher Grigsby & Molly Stevens (Addgene plasmid # 203348 http://n2t.net/addgene:203348 ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-2/1/CAG-Flex-EGFP (Addgene), pENN.AAV.hsyn.Cre.WPRE.hGH (AAV1 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Biochemistry 2022Quote: Human Drp1 (Uniprot ID: O00429-4) with a C-terminal StrepII tag in pET15b (Addgene plasmid #174428) was expressed in BL21(DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17446) (Campeau et al. ...
-
bioRxiv - Genetics 2021Quote: The Drosophila CRISPR genome-wide knockout library was previously described and is available from Addgene (134582-4)20,55 ...
-
bioRxiv - Microbiology 2022Quote: ... The HA-NFAT1(4-460)-GFP plasmid was a gift from Anjana Rao (Addgene plasmid # 11107 ;; RRID:Addgene_11107) [50] ...
-
bioRxiv - Microbiology 2022Quote: ... The HA-NFAT1(4-460)-GFP plasmid was a gift from Anjana Rao (Addgene plasmid # 11107 ;; RRID:Addgene_11107) [50] ...
-
bioRxiv - Neuroscience 2024Quote: ... was injected with a mixture of Cre-expressing and Cre-dependent adeno-associated viral vectors carrying the genes for ChR2 and tdTomato (AAV9.CamKII.4.Cre.SV40 and AAV9.CAG.Flex.ChR2.tdTomato, Addgene). Following a post-injection survival period of 9 weeks ...
-
bioRxiv - Neuroscience 2023Quote: Viral vectors encoding the fluorescent dopamine indicator dLight1.2 (AAV5-hSyn-dLight1.2) (Addgene, titer ≥ 4×10¹² vg/mL) and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40 ...
-
bioRxiv - Cancer Biology 2023Quote: ... They were then transduced with lentivirus containing the plasmid pLenti_CMV_GFP_Hygro [pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene viral prep # 17446-LV ...
-
bioRxiv - Cell Biology 2023Quote: Linear tetra-ubiquitin fused to GST (GST-4×Ub) was cloned into a pGEX-4T1 vector (RRID:Addgene_199779). After the transformation of the pGEX-4T1 vector encoding GST-4×Ub in E ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lenti dCAS-VP64_Blast (4) was a gift from Feng Zhang (Addgene plasmid # 61425; http://n2t.net/addgene:61425; RRID:Addgene_61425). lenti MS2-P65-HSF1_Hygro (4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... lenti MS2-P65-HSF1_Hygro (4) was a gift from Feng Zhang (Addgene plasmid # 61426; http://n2t.net/addgene:61426; RRID:Addgene_61426). lentiMPH v2 (20 ...
-
bioRxiv - Cell Biology 2024Quote: ... a total of 3.65 μg DNA vectors including 0.47 μg pCE-hOCT3/4 (Addgene, MA, U.S.A, #41813), 0.47 μg pCE-hSK (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 week-old male p62 fl/fl mice were transduced with pAAV.TBG.PI.eGFP.WPRE.bGH (AAV8) (Addgene item #105535-AAV8) or AAV.TBG.PI.Cre.rBG (AAV8 ...
-
bioRxiv - Developmental Biology 2024Quote: ... unc-4 and vab-7 homology arms were cloned into the mNG-SEC plasmid pDD268 (Addgene #132523). Primers are listed in Supplemental Table S1.
-
bioRxiv - Cell Biology 2021Quote: ... The resulting scFv fragments were further amplified using the 5’ and 3’ primers (scFv primer_s and scFv primer_as) and cloned into the psfGFP-N1 vector (Addgene #54737 ...
-
bioRxiv - Systems Biology 2022Quote: A Myd88-targeting guide RNA (5’-TCGCGCTTAACGTGGGAGTG-3’) was cloned into the pX330 plasmid backbone (Addgene Plasmid #42230) and transfected using electroporation (Lonza ...
-
bioRxiv - Microbiology 2022Quote: ... The target sequence for the ACE2 gene (5′-TGCTGCTCAGTCCACCATTG-3′) was designed using CRISPR direct (https://crispr.dbcls.jp) and cloned into plentiCRISPR plasmids (21) (Addgene plasmid #52961 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a sgRNA sequence cutting near MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) was cloned into lentiCRISPR v2 plasmid (Addgene #52961). The Tyrosine to Alanine point mutation was introduced using single-strand Ultramer DNA Oligonucleotide (IDT) ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 × 106 293T cells were seeded in a 10-cm plate 1 d prior to transfection and co-tranfected with the 3rd generation lentiviral packaging plasmids (5 µg pVSV.G, 3 µg pMDLg/pRRE, and 2.5 µg pRSV-Rev; Addgene # 14888 ...
-
bioRxiv - Microbiology 2024Quote: ... The 5’ p230p and 3’ p230p targeting sequences were cloned into the pPbU6-hdhfr/yfcu plasmid (Addgene #216422),44 carrying the dual positive and negative selection marker hdhfr-yfcu (human dihydrofolate reductase/yeast cytosine deaminase and uridyl phosphoribosyl transferase ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR donor plasmids were cloned with 0.8 kb 5’ and 3’ homology arms amplified from fly genomic DNA into pUC57(Addgene plasmid #51019, RRID:Addgene_51019), flanking the different CTail Shot-eGFP coding sequences ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Biochemistry 2024Quote: ... or (1/8)NORAD-4xenv8- FL-3’antiPNA (Addgene plasmid #199209). For all experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Cell Biology 2020Quote: ... pLenti [CM V/GFP/Hygro] (656-4) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17446). The cut backbone vector was treated with Antarctic Phosphatase (cat# M0289S ...
-
bioRxiv - Neuroscience 2021Quote: ... Subset of pups were bilaterally injected with 4 μl AAV9-hsyn-EGFP (3.4×10^13 gc/ml, Addgene) or 4 μl ACh3.0 (1.8×10^13 gc/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #17446; http://n2t.net/addgene:17446; RRID:Addgene_17446)65 ...
-
bioRxiv - Biochemistry 2022Quote: HEK293T cells were transiently transfected with pGP-CMV-GcAMP6s (Ca2+ Sensor plasmid, Addgene, Cat. no. 40753; 4 µg), 5HT2c receptor (as positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and subcloned into pLenti-CMV-GFP-Hygro (656-4) (gifted from Eric Campeau & Paul Kaufman; Addgene plasmid # 17446) using NEBuilder® HiFi DNA Assembly Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: The genome-wide Brie CRISPR-KO library (4 sgRNAs per gene; ~ 80.000 sgRNAs) was purchased from Addgene (#73632) and amplified according to the supplier’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transfection was performed with control vector (pcDNA/GW-40/LacZ) or 4 μg pARID1A (Addgene catalogue number 39311) using FuGENE 6 Transfection Reagent (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... Electrocompetent BW25113 cells were co-transformed with the pORTMAGE-4 plasmid (Addgene plasmid #72679, courtesy of Csaba Pál) and the pBAD-yTrm5 plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Neuroscience 2022Quote: ... Pups were injected bilaterally with 4 ul of AAV9-hSyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene). Mice also received an injection of AAV9-hSyn-GRABACh3.0 to express the genetically encoded cholinergic sensor GRABACh3.0 48 ...
-
bioRxiv - Cancer Biology 2023Quote: KEAP1-sg1 knockout H1299 (4 x 105) cells were transfected with or without plasmid expressing Halo-KEAP1 (Addgene, a gift from Yimon Aye ...