Labshake search
Citations for Addgene :
201 - 250 of 3258 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 4 μg of pMD2.G (Addgene #12259), 4 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Immunology 2023Quote: BMDMs grown on 4-well chamber were transfected with GEM-CEPIA1er (Addgene) (Suzuki et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pMD2G envelope plasmid (4 µg, a gift from Didier Trono; Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used AAV2/9-pAAV-hDlx-hM3Dq-dTomato-Fishell-4 (Addgene, 83897) and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 μg of pMD2.G (gift from Didier Trono, Addgene #12259) plasmids in Opti-MEM (Gibco ...
-
bioRxiv - Biochemistry 2024Quote: Human Drosha isoform 4 and human DGCR8 clones were purchased from Addgene. cDNA encoding different length variants of Drosha were cloned into pFL plasmid and expressed as a N-terminal Dual-strep tag fusion ...
-
bioRxiv - Molecular Biology 2024Quote: ... lenti MS2-P65-HSF1_Hygro (4) was a gift from Feng Zhang (Addgene plasmid # 61426 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with plasmids expressing VSV-G (4 μg; Addgene #12259), Gag-Pol (3.375 μg ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with plasmids expressing VSV-G (4 μg; Addgene #12259), Gag-Pol (3.375 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... The following guides 5’-GGACCTGTTCGGAATCCACC-3’ and 5’-GGGTGAGGTTCTGTCTACCC-3 were separately cloned into the BbsI site of pU6-BbsI-chiRNA plasmid (obtained from Addgene) and both were simultaneously injected by Best Gene into w1118 ...
-
bioRxiv - Developmental Biology 2021Quote: For mammalian 2-hybrid assays 2.15 x 105 HEK293 or 4 x 105 A375 cells were transiently transfected with 1 µg firefly luciferase reporter plasmid (5xGAL4-TATA-luciferase, Addgene, 46756) (Sun et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Cancer Biology 2023Quote: ... or FAXDC2 sg RNAs (sg3 5’-TCTTGTTCTACTATTCACAC-3’, sg4-TGGGGAAAGATATCATGCAC-3’) were cloned into was cloned into FgH1tUTG or FgH1tUTCyan plasmid (Addgene #85551) plasmids respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... The guide RNA targeting sequence 5’- TGGTCGTGGATACGAGAAGA-3’ was inserted into the Peft-3>Cas9 + sgRNA plasmid pDD162 [12] (Addgene #47549) using a Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Cell Biology 2024Quote: ... These were amplified by two miR-E universal primers (fwd 5′-CTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGA CAGTGAGCG-3′) (rev 5′-ACAAGATAATTGCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGT AGGCA-3′) and cloned into the XhoI and EcoRI double digested LT3GEPIR lentiviral vector (Addgene #111177). HEK293T cells were transfected with these vectors to produce lentivirus which was then used to transduce lamin TKO mESCs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5’- GTATTTTCAGGGATCGCCGCTAGCGCTACCGG-3’ and rev: 5’-TCGGGGAGCTGGATCCTCCGCCAGCGCTGC-3’ and inserted into BamHI site of pQE-80L MBP-SspB Nano plasmid (Addgene #60409) by using Gibson assembly ...
-
bioRxiv - Neuroscience 2024Quote: ... a 448 bp human synapsin-1 promoter element driving the neuronal specific expression of 4) the fluorescent protein mTagBFP2 (Addgene plasmid #191566 pLKO.1-TRC mTagBFP2) fused to the plasma membrane targeting sequence CAAX2 (Addgene plasmid #162247 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the guide RNA targeting HDAC6 exon 5 (5’-GAAAGGACACGCAGCGATCT-3’) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961). The HDAC6-KO vector can also express the codon-optimized Cas9 protein as well as puromycin resistance gene ...
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Cell Biology 2023Quote: The FL and 4H TLNRD1 were described previously (Cowell et al., 2021) and are available on Addgene (Addgene plasmids 159384 and 159386). The FL CCM2 constructs were purchased from GeneArt and subcloned into pET151 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of packaging vector psPAX2 (gift from Didier Trono (Addgene plasmid # 12260)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was mixed with 4 μg of DNA RV helper plasmid (Addgene, plasmid #12371), in 1800 μl of Opti-MEM reduced serum medium (ThermoFisher ...
-
bioRxiv - Physiology 2021Quote: ... 200nL AAV-hM3D(G)q-mCherry (Addgene 44361-AAV8, 4×1012 vg/mL) was injected bilaterally at 50nl/min and mice were allowed 2 weeks recovery prior to testing ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were transfected with 0.5 μg of EGFP-PGC-1α FL (Addgene, #4) or ΔCTD for 24 h.
-
bioRxiv - Cancer Biology 2023Quote: ... 4 μg of packaging vector psPAX2 (gift from Didier Trono (Addgene plasmid # 12260), 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Immunology 2023Quote: ‘CD44-isoform1-CD4d3+4-bio’ plasmid was obtained from Addgene (# 73098, Watertown, MA26). The extracellular region of CD44 was PCR amplified from this construct using primers listed in Supplementary Table S3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... a sgRNA targeting the 3’ end of Spen ORF (5’-GATTGTCATTGCCTCGGTG-3’) was cloned in the Cas9-PuroR pX459 vector (Addgene plasmid #62988). The donor template was made using a gblock from Integrated DNA Technologies coding for compatible 5’ and 3’ HA of 600 bp with a NheI and AscI restrictions sites in-between the 5’ and 3’ HA ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5’- CGCGTCGACATGGTGAGCAAGGGCGAGGA-3’ and mCh REV: 5’-ACGCGGATCCCTTGTACAGCTCGTCCATGC-3’ and ligating it into pENTR4 no ccDB (gift from E. Campeau, Addgene plasmid #17424) plasmid (Campeau ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-GCGCCTCCTGCGAAGCCATCAGG-3’ and 5’-CGTAGCGGGAAGGGTCAAGAGGG-3’) were similarly cloned into the lentiCRISPRv2-hygro vector (a gift from Brett Stringer, Addgene plasmid #98291)51.
-
bioRxiv - Molecular Biology 2024Quote: ... a sgRNA (5’-GCTAGTGGAGAACTTGGAAA-3’) targeting the R164-allele of PCNA exon 5 was cloned into hSpCas9(BB)-2A-GFP (PX458, Addgene 48138). A double-stranded donor was constructed with a point mutation to revert the arginine (AGA ...
-
bioRxiv - Physiology 2024Quote: ... a sgRNA was designed for exon 5 of PKHD1 (5’-3’ ACTTCCTGGAAGCATACTTC) and cloned into a pX330 plasmid (Addgene plasmid, 42230). HCD cells were transfected with the sgRNA encoding plasmid and pAcGFP1-C1 plasmid using FuGENE (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...
-
bioRxiv - Cancer Biology 2021Quote: The Rb1 CRISPR plasmid with gRNA sequence 5-GCTCTGGGTCCTCCTCAGGA-3 (TLCV2-RB1, Addgene#87836) was purchased from Addgene ...
-
MEK inhibitor resistance in lung cancer cells associated with addiction to sustained ERK suppressionbioRxiv - Cancer Biology 2022Quote: The sgRNA sequence for RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) was cloned into lentiCRISPRv2 (Addgene #52961) plasmid and the co-transfected with psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2021Quote: ... laevis b-globin 5′- and 3′-UTR sequences were obtained from pT7TS (Addgene #17091). Mouse Malat1 3′ sequence was obtained from the Comp.25 mutant plasmid (Wilusz et al. ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...