Labshake search
Citations for Addgene :
151 - 200 of 3258 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-hDlx-GqDREADD-dTomato-Fishell-4 (Addgene, 83897-AAV9) viruses were injected in C57Bl6-Jax mice or in some cases in rats ...
-
bioRxiv - Synthetic Biology 2024Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ...
-
bioRxiv - Neuroscience 2024Quote: pENN.AAV9.CamKII.4.eGFP.WPRE.rBG (Addgene viral prep # 105541-AAV9) was added to the cortical organoids at day 278 (1.68×108 GC/well) ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(W276A/I279A/I307A/V310A)-GFP (ΔLIR1+4) (RRID:Addgene_223781), BCL2L13(I224A/L227A/W276A/I279A/I307A/V310A)-GFP (ΔLIR1+3+4 ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Cancer Biology 2024Quote: ... or shRNAs against YAP (5’-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC -3’, cat. 27368, Addgene, pLKO1-shYAP1 was a gift from Kunliang Guan ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Neuroscience 2020Quote: [4] T2A-GCaMP6s from pGP-CMV-GCaMP6s (Addgene plasmid #40753) with T2A sequence includedintheforwardprimer(underlined ...
-
bioRxiv - Neuroscience 2020Quote: ... two unc-4 sgRNA plasmids and Cas9 plasmid (Addgene #46168) (Friedland et al. ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Immunology 2022Quote: ... Cells were transfected with 4 mg of SNAP-CD59 (Addgene) using Lipofectamine 3000 (Life Technologies) ...
-
bioRxiv - Genomics 2022Quote: ... 4 µg of the envelope-encoding plasmid pVSVg (Addgene 12260) and 7.5 µg of the packaging plasmid psPAX2 (Addgene 8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4 μg of envelope plasmid (pMD2.G; Addgene #12259) with 112 μg PEI MAX (Polysciences ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 µg of the viral packing PsPAX (Addgene #12260) plasmids using the Polyfect reagent according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 µg sgRNAb/Cas9 plasmid (Addgene 62988, Supplementary table 6), 200 µl Opti-Mem and 25 µl Lipofectamine 2000 was prepared ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Neuroscience 2024Quote: ... or the control reporter mCherry (AAV5-hsyn-DIO-mcherry, Addgene #50459 titre: 1:4 – 7×10¹² GC/mL).
-
bioRxiv - Neuroscience 2024Quote: ... Gq DREADD virus (n=23, 12 males, 11 females: AAV8-hSyn-DIO-hM3Dq-mCherry, ≥ 4×101 2 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express excitatory designer receptors in VP GABA neurons ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Bioengineering 2020Quote: ... sgRNA targeting TP53 gene exon 5 (5’-GTTGATTCCACACCCCC.GCCcgg-3’) was cloned into lentiGuide-Puro vector (Addgene, #52963), named lentiGuide-Puro_e5.2 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two guide RNA sequences were selected to target exon 1 of mtIF3 as described previously (5′-GCAAUAGGGGACAACUGUGC-3′ and 5′-GCAGAGUAUCAGCUCAUGAC-3′) 59 and cloned into the pL-CRISPR.EFS.GFP (a gift from Benjamin Ebert, Addgene plasmid # 57818 ...
-
bioRxiv - Cell Biology 2024Quote: ... and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Neuroscience 2021Quote: ... 4 μg of the second-generation packaging plasmid psPAX2 (Addgene; 12260), and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235). A His2Av polyA sequence after the BFP/Gal80 coding sequence was PCR amplified from pDEST-HemmarR2 (Addgene # 112813).
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Genetics 2020Quote: ... Gal80 coding sequence was PCR amplified from pBPGAL80Uw-4 (Addgene 26235) using the oligonucleotides aaaaaaaaatcaaaATGAGCGGTACCGATTACAACAAAAGGAGTAGTGTGAG and GCCGACTGGCTTAGTTAattaattctagaTTAAAGCGAGTAGTGGGAGATGTTG ...
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAV2.CAG.tdTomato (Addgene, #59462-AAV2, titer: 4×10¹² vg/mL) were used ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lenti dCAS-VP64_Blast (4) was a gift from Feng Zhang (Addgene plasmid # 61425 ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Cell Biology 2024Quote: ... were constructed by inserting annealed synthetic oligomers (5′-CACCgcagctcctgcctctcatcg-3′ and 5′-AAACcgatgagaggcaggagctgc-3′) into the Bbs I site of pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (#42230; Addgene, Watertown ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA targeting Pml exon 1 (Table 4) was subcloned into the pSpCas9 (BB)-2A-Puro plasmid (pX459v2, Addgene) and transfection of mESCs was performed using lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: Rats were anesthetized with isoflurane (induction: 4%; maintenance: 1–2.5%) and received either AAV8-hSyn-hM4Di-mCherry (Addgene #50475-AAV8) or AAV8-hSyn-mCherry (Addgene #114472-AAV8) ...
-
bioRxiv - Microbiology 2024Quote: 10-cm dishes containing 50-80% confluent 293T cells in 10% FBS/DMEM were co-transfected with 4 µg of spike pcDNA3.1(+) or 1 µg spike VRC8400 plasmids and 0.5 µg of eGFP plasmid (Addgene plasmid # 160697) [61] (Effector cells ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... or RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) were cloned into the lentiCRISPRv2 (Addgene #52961) plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: ... co-injection marker pCFJ104 (Pmyo-3-mCherry; Addgene #19328, 5 ng/µL) and marker pCFJ90 (Pmyo-2-mCherry ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076] ...