Labshake search
Citations for Addgene :
551 - 600 of 3258 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... a pRSFDuet-1 plasmid containing His6-SUMO SARS-CoV-2 nsp12 (Addgene #159107) was transformed into E ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Neuroscience 2021Quote: ... 500–550 nl of AAV9-Syn-jGCaMP7f-WPRE virus (diluted 1:2; Addgene) was injected in dorsal CA1 to express synapsin-driven calcium sensor jGCaMP7f (injection coordinates ...
-
bioRxiv - Cell Biology 2022Quote: ... 1–2 (lenti-TRE3G-ApaLI(*)-Hygro) were cloned into LT3REVIR (Addgene Plasmid #111176) by inserting mito-ApaLI(* ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.50 µL of AAV5.FLEX.ArchT.tdTomato (diluted 1:2 with dPBS; Addgene number: 28305) was injected in basal forebrain of ChAT-Cre animals using the coordinates described above ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted to 1/2) or AAV-Ef1a-mCherry (#114470-AAV9, obtained from Addgene; titer ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP-targeting shRNA vectors 1 and 2 refer to pLKO1-shYAP1 (Addgene, #27368) and pLKO1-shYAP2 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: AAV2/1-syn-GCaMP7s (Addgene 104487, 100–200 nl, 2 × 1013 GC / ml) was unilaterally injected into the MPOA of C57BL/6J mice using a Nanoject II or Nanoject III injector (Drummond Scientific ...
-
bioRxiv - Physiology 2022Quote: ... or scramble short hairpin RNA (shRNA) (Table 3) was inserted into the plasmid pLKO.1 (8453; Addgene). pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Neuroscience 2024Quote: ... DV: -0.4) and 0.3μl of AAV.PHP.eB-CAG-DIO-tdTomato (28306-PHPeB, Addgene, 1×10¹3 vg/mL) was injected at a rate of 0.05μl/min ...
-
bioRxiv - Cell Biology 2020Quote: ... and pET28a(+) (Addgene #69864-3), for His6-tag protein purification ...
-
bioRxiv - Systems Biology 2024Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher #11791100) ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: - vector pGEX-4T-3 (Addgene_79149) to express only GST protein for alternative screening.
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and our previously verified sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN120 from pLentiCRISPRv2 (Addgene #52961; a gift from Feng Zhang) via lentiviral transduction ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Biochemistry 2024Quote: ... pLKO.1 puro CXCR4 siRNA-1 and siRNA-2 were gifts from Bob Weinberg (Addgene plasmids #12271 and #12272). plKO.1 scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864) ...
-
bioRxiv - Immunology 2021Quote: ... and the third exon of NCR3 (conserved in 3 of the 4 longest isoforms of NCR3 with transcript ID ENST00000376073) were designed and cloned into the lentiCRISPR V2 vector (Addgene #52961, sgRNA sequences in Table S1). Lentiviruses were produced in HEK293T cells using standard laboratory protocols ...
-
bioRxiv - Bioengineering 2020Quote: ... The eluted fractions were then pooled together and underwent TEV cleavage overnight at 4°C (TEV protease was purified using the plasmid pRK793, #8827 from Addgene, a gift from David Waugh Lab).
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 µL of EnvA G-Deleted Rabies-mCherry (diluted 1:5 in dPBS; Addgene: 32636) was injected in the basal forebrain using the same coordinates ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN glia AAV-5: pZac2.1 gfaABC1D-cyto-GCaMP6f at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Microbiology 2021Quote: Chemical-genetic screens were initiated by thawing 5 × 1 mL (1 OD600 unit per mL) aliquots of the Mtb CRISPRi library (RLC12; Addgene #163954) and inoculating each aliquot into 19 mL 7H9 supplemented with kanamycin (10 μg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... were coated with 200 nL of a 1:1 mixture of 5% silk fibers and AAV9.CaMKII.GCaMP6f.WPRE.SV40 (Addgene viral prep # 100834-AAV9), as previously described by 70 ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Biochemistry 2024Quote: ... according to manufacturer protocol with 2:1 donor:sleeping beauty transposase plasmids (Addgene Plasmid #34879)80 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μg pMD2.G (Addgene #12259), 12 μg pCMV delta R8.2 (Addgene #12263) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-ER-3 (Addgene plasmid #54082), and calnexin-mEmerlad (Addgene plasmid #54021 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μg psPax vector (Addgene #12260), 1.5 μg pMD2.G vector (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFJ104 (Pmyo-3::mCherry, Addgene #19328) and pGH8 (Prab-3::mCherry ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 µg pMD2.G (Addgene #12259) and 9 µg lentiviral vector were diluted in 1.2 mL OptiMEM ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg of psPAX2 (Addgene #12260), and 1.5 µg of the pMD2.G plasmid (Addgene #12259 ...
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were infused with diluted (1:5) or undiluted virus pAAV5-CAMKIIa-(hChR2- H134R)-eYFP (Addgene-ChR2 titre ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...