Labshake search
Citations for Addgene :
2851 - 2862 of 2862 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Cas9-expressing recipient-cells either iCasp1−/−/Casp11−/− or iNlrc4−/− (1,000,000 cells/well in 6-well plates) were generated by lentiviral transduction with Cas9-expressing lentiviral vector (lentiCas9-Blast, Addgene 52962, from Feng Zhang lab) and then infected with the lenti-Guide viral particles in presence of 8μg/ml polybrene and centrifugated for 2 h at 2900 rpm at 32°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Nalm6 and BL2 cells were performed by lentiviral delivery of Cas9 and the sgRNA using the lentiCRISPR v2 backbone (#52961 – Addgene; a gift from Feng Zhang) (58) ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Genetics 2019Quote: ... PRDM9 with a C-terminal V5 or N-terminal YFP tag for expression in mammalian cells (pLENTI CMV/TO Puro DEST backbone vector, Addgene plasmid # 17293; Campeau et al., 2009) were described previously (Altemose et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... IFT121 and IFT139 in IMCD-3 cells were designed using Benchling software and cloned into the pX330 vector (gift from Feng Zhang; Addgene plasmid # 42230; (Cong et al., 2013)) ...
-
bioRxiv - Microbiology 2022Quote: All lentiviruses vector particles were generated in HEK-293T cells by co-transfection with plasmids pMD2.g and psPAX2 (Addgene # 12259, #12260, gift of Didier Trono), exactly as described previously (43) ...
-
bioRxiv - Microbiology 2023Quote: ... We first generated a CRISPRi cell line by transducing J-Lat A72 with the vector lenti-EF1a-dCas9-KRAB-Puro (Addgene #99372, a gift from Kristen Brennand). After selecting with puromycin-containing media (1 μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral vectors expressing the cDNA of wild-type c-Myc and GFP in the murine stem cell virus backbone were purchased from Addgene (MSCV-Myc-IRES-GFP, Plasmid #18770). Doxycycline-inducible constructs were obtained by cloning c-Myc cDNA into GC385-S backbone ...
-
bioRxiv - Cell Biology 2024Quote: To generate RRBP1 KO HEK293T cells expressing EGFP-FLAG-APEX2-ePTS1 single gRNA transcriptional cassette prepared by PCR and pCAS9-mCherry empty (Addgene, 80975 (Schmid- Burgk et al., 2016)) were co-transfected into HEK293T cells expressing EGFP-FLAG-APEX2- ePTS1 ...
-
bioRxiv - Microbiology 2024Quote: ... HEK293T cells were cultured in 10-cm dishes and transiently transfected with 9 µg lentiviral plasmid pLV-ER-GFP (Addgene, 80069, a gift from Pantelis Tsoulfas), 8 µg pCMV-dR8.91 ...
-
bioRxiv - Cell Biology 2019Quote: Wild-type or SURF4-deficient HEK293T cells that stably express EPO-eGFP and A1AT-mCherry were transfected with a plasmid expressing ERoxBFP (Addgene: 68126, a gift from Erik Snapp (99)) ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells expressing doxycycline (DOX)-activated DHFR-UBA5 were cotransfected with two plasmids: (1) pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230, a gift from Feng Zhang), for expression of human codon-optimized SpCas9 and sgRNA UBA5 (ACCTACTATTGCTACGGCAA) ...