Labshake search
Citations for Addgene :
2501 - 2550 of 2862 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... In vitro target specific gRNA cleavage activity was validated by transfecting N2A cells with PCR amplified gRNA gblock and Cas9 plasmid DNA (px330, Addgene) using ROCHE Xtremegene HP ...
-
bioRxiv - Cell Biology 2023Quote: ... Tetracycline-on (Tet-on) cells were generated by lentiviral transduction with a pCW57.1 vector (Addgene plasmid 41393, David Root lab) containing a single-vector Tet-on component and were cultured in the presence of 1 µg/ml doxycycline (Clontech ...
-
bioRxiv - Molecular Biology 2024Quote: The 2C::tdTomato reporter cell line was generated by transfection of EB3 mESCs (catalog no. AES0139, RIKEN BRC Cell Bank) with a linearized 2C::tdTomato reporter plasmid (catalog no. 40281, Addgene). After 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... the plasmid to be packaged was co-transfected into HEK293T cells with a rep/cap containing plasmid pUCmini-iCAP-PHP.eB (Addgene #103005) and the helper plasmid pAdDeltaF6 (Addgene #112867) ...
-
bioRxiv - Microbiology 2023Quote: ... in 293-LTV cells transfected using jetPRIME (Polypus 101000027) with plasmids pCMV-VSV-G (a gift from Bob Weinberg Addgene plasmid # 8454 ...
-
bioRxiv - Bioengineering 2023Quote: Reporter cell lines for Cas9 and base editors were generated using lentiviruses made from CRISPR-SP-Cas9 reporter (Addgene #62733), pLV-SI-121 (Addgene #131126 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Breast cells were transduced at a high multiplicity of infection (MOI) with either Cas13d or CRISPRa (dCas9-VP64; Addgene #61425) lentivirus by spinoculation at 2,500 rpm for 1.5h at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Cell Biology 2023Quote: ... Non-GFP expressing ZT cells were obtained by sorting out non-fluorescence ZT cells and they were subsequently immortalized by transfecting them with SV40 T-antigen expressing plasmid (Addgene).
-
bioRxiv - Cell Biology 2023Quote: HEK293T-LentiX cells were co-transfected for 12 h with 10 µg psPAX2 (kind gift from Didier Trono, Addgene #12260), 2.5 µg pMD2.G (kind gift from Didier Trono ...
-
bioRxiv - Molecular Biology 2023Quote: Vero E6-TMPRSS2 cells were generated by transduction with a 2nd generation lentiviral vector pLEX307-TMPRSS2-blast (Addgene plasmid #158458) and selected for two weeks in DMEM containing 20 µg/mL of Blasticidin (Cat# SBR00022 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were co-transfected with two gRNAs and pSpCas9n(BB)-2A-Puro (PX462) V2.0 (Addgene, 62987 (Ran et al., 2013)) ...
-
bioRxiv - Genetics 2024Quote: ... The resulting plasmid was transfected into HEK-239T cells along with a PX459 (Addgene #48139, kindly deposited by Feng Zhang) plasmid encoding Cas9 and an sgRNA (CTTTCTGCCCACACTAGACA ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
bioRxiv - Cell Biology 2024Quote: ... 700,000 HEK293T cells were seeded onto a 6-well plate and 24 hours later transfected with 200 ng pMD2.G (Addgene), 400 ng psPAX2 (Addgene) ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
bioRxiv - Microbiology 2024Quote: ... A549 cells were transfected with 2 µg DNA of ARF1-GFP48 (ARF1-GFP was a gift from Paul Melancon, Addgene plasmid #39554 ...
-
bioRxiv - Molecular Biology 2024Quote: ... were generated by lentiviral transduction of R3.8Cas9 cells with the corresponding single guide RNAs (sgRNAs) cloned in vector pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene #67974) as previously described [26] ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells carrying inducible Cas9 and the WNK1 sgRNAs were infected with either EGFP-expressing lentiviral particles (FUGW-EGFP, Addgene #14883) or FUGW-mRuby3-expressing lentiviral particles (34) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected using standard polyethylenimine (PEI) protocols in suspension at time of seeding with 30 ng reporter HRELuc (Addgene #26731 ...
-
bioRxiv - Biochemistry 2024Quote: HEK293FT cell were transiently co-transfected with the fluorescent citrate sensor Citron (CMV-Citron1, AddGene #134303 (Zhao et al., 2020)) and either pcDNA3.1 carrying the WT or mutant genes T227M ...
-
bioRxiv - Microbiology 2024Quote: ... BHK-21/WI-2 culture supernatants were filtered (0.22 μm) and used to inoculate 293T cells that had been transfected 24 h previously with pMD2.G (Addgene 12259). At 24 h post-inoculation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviruses were generated by transfecting sub-confluent HEK293T cells along with the lentiviral vector and packaging vectors pCMV-VSV-G (Addgene, Cat. 8454, RRID: Addgene_8454) and psPAX2 (Addgene ...
-
Tumor microenvironment acidosis favors pancreatic cancer stem cell properties and in vivo metastasisbioRxiv - Cancer Biology 2024Quote: Cells were seeded in 12-well plates and transfected at 50-70% confluence with 0.5 µg/well TOPflash (Addgene, #12456) and 0.3 µg pRL-TK (Promega ...
-
bioRxiv - Cell Biology 2024Quote: The monoclonal SK-N-DZ SCLYKO cell line was transduced with Toronto KnockOut (TKO) CRISPR Library - Version 3 (Addgene, 90294) at MOI of 0.3 ...
-
bioRxiv - Systems Biology 2024Quote: ... cells were transfected with a pCMV-Grx1roGFP2-Hygromycin vector then the stable cell lines were selected with hygromycin B (the vector was modified from pEIGW-Grx1-roGFP2, 64990, Addgene). The information obtained from Grx1-roGFP2 fluorescence is not utilized in this work.
-
bioRxiv - Microbiology 2024Quote: ... and SV2B K562-DCSIGN KO cell lines were generated via nucleofection with top-ranking sgRNAs (Table S4) cloned into px458 (Cat# 48138, Addgene). One million cells resuspended in 100 μL of SF Cell Line Nucleofector solution (Lonza V4XC-2012 ...
-
bioRxiv - Microbiology 2024Quote: K562-Cas9-Blast cells (provided by Andreas Puschnik, Chan Zuckerberg Biohub, San Francisco) were generated by transduction with lentiCas9-Blast (Cat# 52962, Addgene) and selection with blasticidin as described previously [38] ...
-
bioRxiv - Molecular Biology 2024Quote: We transfected HAP1 cells with 2 µg of pX330 U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230; (Cong et al, 2013)) containing LAD-specific or AVVS1-specific guide RNAs ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK-293T cells were co-transfected with lentivirus construct encoding Cas9 and a sgRNA targeting exon 7 of ATG5 (LentiCRISPRv2-ATG5; Addgene, 99573 [17] ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transformed with pET28a plasmid encoding the amber mutant TTC5 and the pEVOL-pBpF plasmid (Addgene plasmid #31190). Cells were grown at 37 °C in LB containing 50 μg/mL kanamycin and 25 μg/mL chloramphenicol and induced with 0.2 % L-arabinose at an A600 of 0.3 for 30 min followed by a second induction with 0.2 mM IPTG at an A600 of ∼0.6 at 16 °C overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... MOLM-13/Cas9+ cell line stably expressing luciferase was established via lentiviral infection with a Lenti-luciferase-P2A-Neo (Addgene # 105621) vector followed by G418 (1 mg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: HEK293T cells were transfected with plasmids encoding for Flag-p105 or Flag-p27 together with the plasmid HA-Ubiquitin (Addgene #18712). After 24h ...
-
bioRxiv - Cell Biology 2020Quote: Approximately 300 × 106 IAPEz reporter cells expressing Cas9 were lentivirally infected with a genome-wide Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene #1000000096) as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... The hTERT-RPE1 GFP-LC3-RFP reporter cell line was generated by transducing hTERT-RPE1(Cas9) cells with retroviral particles generated with the transfer plasmid pMRX-IP-GFP-LC3-RFP (Addgene: 84573). Single cell clones were isolated and reporter functionality was tested by Torin1 and Bafilomycin A1 treatments.
-
bioRxiv - Genetics 2021Quote: Lentivirus was produced by transfecting 293T cells with the gRNA and KRAB-dCas9 expression plasmid together with the packaging plasmids VsVg (Addgene 12259) and psPax2 (Addgene 12260 ...
-
bioRxiv - Developmental Biology 2021Quote: For mammalian 2-hybrid assays 2.15 x 105 HEK293 or 4 x 105 A375 cells were transiently transfected with 1 µg firefly luciferase reporter plasmid (5xGAL4-TATA-luciferase, Addgene, 46756) (Sun et al ...
-
bioRxiv - Biophysics 2022Quote: ... Lentivirus expressing LifeAct-GFP were produced in HEK 293T cells by cotransfecting the lentiviral plasmids pLenti.PGK.LifeAct-GFP.W (a gift from Rusty Lansford, Addgene plasmid #51010; Watertown, MA) with psPAX2 and pMD2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 million cells per replicate were activated and 12-20 h later electroporated with the pSpCas9(BB)-2A-GFP plasmid (pX458; Addgene 48138) expressing the Myc sgRNA using the MaxCyte STx transfection system (MaxCyte) ...
-
bioRxiv - Cell Biology 2022Quote: Lentivirus particles were generated from HEK293T cells (ATCC CRL-3216) by co-transfection of lentiviral vectors with the packaging plasmid psPAX2 (Addgene #12260) and envelope plasmid pMD2G (Addgene #12259 ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... and Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399). Successful incorporation of pShuttle-CMV construct into AdEasier-1 cells confirmed via digestion with PacI (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: Lentiviral particles to generate CRISPR/Cas9-edited cell lines were produced by transfecting 10 cm dishes of HEK293T cells with 1.5 μg of pLentiCRISPRv2 encoding gene specific guide RNAs (Addgene plasmid #52961), 1 μg of p8.91 packaging plasmid(Zufferey et al. ...
-
bioRxiv - Genomics 2020Quote: ... Separately infected cells were counted and pooled after selection with puromycin and KRAB-dCas9 (TRE-KRAB-dCas9-IRES-BFP, Addgene 85449) was induced with 1 μg/ml doxycycline (Millipore Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: OsTIR1 was integrated into AAVS1 locus of the HEK293T cells using the CMV-OsTIR1-PURO plasmid from Masato Kanemaki (pMK232, Addgene #72834) (Natsume et al ...
-
bioRxiv - Genetics 2019Quote: ... CRISPRi-FlowFISH and qPCR experiments used K562 cells expressing KRAB-dCas9-IRES-BFP from a third generation tet-inducible promoter (Addgene # 85449).
-
bioRxiv - Immunology 2019Quote: ... or VPR WT or a Q65R VPR mutant were produced through co-transfection of 293T cells with 4 plasmids coding for Gag/Pol (Addgene #12251), Rev (Addgene #12253) ...
-
bioRxiv - Cancer Biology 2019Quote: Viral particles were produced in 293T cells by co-transfecting plasmids of interest along with a lentivirus packaging plasmid (psPAX2, Addgene #12260) and a VSV envelope expression plasmid (pMD2.G ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 scrambled shRNA or Sirt4 shRNA was transfected in HEK293 T cells with packaging plasmids pMD2.G (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260) ...
-
bioRxiv - Immunology 2021Quote: TXN1-/- HEK 293T cells were prepared by transient transfection of HEK 293T cells stably expressing Cas9 with sgRNA for TXN1 packaged in lentiGuide-Puro (Addgene, 52963) using the following oligo sequences (5’-ACGTGATATTCCTTGAAGTA-3’ ...