Labshake search
Citations for Addgene :
2551 - 2600 of 2862 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: The control and LKB1-KO lines were generated by infecting the cell lines with lentivirus generated from the LentiCRISPRv2 plasmid (Addgene: 52961). The control and TPI1-KO or SIK-KO lines were generated by infecting the Cas9-expressing lines (LentiCRISPRv2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentiviruses were produced by transfecting HEK-293T cells with the transfer lentiCRISPR v2 plasmids and packaging plasmids pLTR-G (Addgene, 17532) and pCD/NL-BH*DDD (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: Viral particles for the generation of stable overexpressed cell lines were produced by co-transfection of pLEX_307 (a gift from David Root, Addgene plasmid # 41392) containing the target gene ...
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells seeded on 35mm MatTek chambers with 70% confluency were loaded with 1 µg of smFLAG-KDM5B-24×MS2 (Addgene #81084), 0.5 µg of anti-FLAG FB-GFP and 130 ng of purified MCP-HaloTag protein by bead loading (Cialek et al. ...
-
bioRxiv - Microbiology 2020Quote: Epitope-tagged expression constructs were made by first cloning cDNAs from RAW 264.7 cell RNA into pENTR1a entry vectors with indicated tags (Addgene Plasmid #17396)(Campeau et al. ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK 293T cells (ATCC CRL-11268) were transfected with expression vectors for the ribozyme-flanked viral genome (cSPBN-4GFP (Addgene 52487) or pRVΔG-4tdTomato (Addgene 52500)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and to the cell suspension was also added 8 ug of donor plasmid (AICSDP-52: HIST1H2BJ-mEGFP is Addgene plasmid # 109121). Cells were then electroporated using a Gene Pulser Xcell electroporation system at 160 V for 30 ms ...
-
bioRxiv - Microbiology 2019Quote: ... lentiparticles to generate CRISPR/Cas9-edited cell lines were produced by transfecting 10 cm dishes of HEK293T cells with 1.5 µg of plentiCRISPRv2 encoding gene specific guide RNAs (Addgene plasmid #52961), 1 µg of p8.91 packaging plasmid (Zufferey ...
-
bioRxiv - Cancer Biology 2020Quote: The dCas9-KRAB constructs were transfected in 293T cells with the 2nd generation lentiviral packaging and envelope plasmids psPAX2 and pMD2.g (Addgene, USA), using CaCl2 2.5M (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: Virus particles were generated in HEK 293-T cells after transfection with the above-mentioned plasmids in combination with the gag/pol plasmid psPAX2 (Addgene, 12260) and the VSV-g-envelope plasmid pMD2.G (Addgene ...
-
bioRxiv - Physiology 2022Quote: ... 60% confluent monolayers of 293-T cells were transfected with LV shuttle vector pUltra-hot-LT and the packaging plasmids psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Genomics 2022Quote: AAV coding STAT5bCA and Luciferase (control) was prepared and quantified by triple transfection of HEK293FT cells using methods adapted from protocols provided by Addgene (www.addgene.org). HEK293FT is a fast growing and highly transfectable derivative (cat ...
-
bioRxiv - Microbiology 2022Quote: The full-length 3CLpro sequence of RHDV2 was codon-optimized for protein expression in mammalian cells, synthesized by Integrated DNA Technologies (Coralville, IA) and inserted into pcDNA3 H2B-mIFP T2A Mpro (3CLpro) (Addgene, MA) following digesting with BamH1 and ApaI ...
-
bioRxiv - Genetics 2022Quote: ... Flox cells were grown in 24-well plates for 24h and then transfected with 130ng of H2B-GFP plasmid (Addgene, 11680). After 5h ...
-
bioRxiv - Cancer Biology 2022Quote: MIA PaCa-2 wild type (WT) and TSC1/TSC2 knockout (KO) cells were transduced with retrovirus expressing RFP (pQCXIP-turboRFP, Addgene #73016) or EGFP (pQCXIP-EGFP-F ...
-
bioRxiv - Immunology 2022Quote: Lentiviruses pseudotyped with HIV-1 env were prepared by transfecting the Lenti-X 293T cells with pCMV-dR8.3 Δvpr (Addgene plasmid #8455), pLOX-CW-tdTomato ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... low passage HEK293T cells were co-transfected with the corresponding pInducer20-FLAG-SMS2 construct and the packaging vectors psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: Stable dCas9-KRAB expressing MCF7 and SUM44 cell lines were generated by lentiviral transduction using Lenti-dCas9-KRAB-blast (Addgene #89567) transfer vector and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cas9-expressing A375 cells were transduced with lentivirus containing expression plasmid pXPR-011 (gift of John Doench and David Root; Addgene #59702), which encodes for enhanced green fluorescent protein (EGFP ...
-
bioRxiv - Cancer Biology 2022Quote: pLX_311-Cas9 lentivirus was produced via transfection of HEK293T cells as described above (plasmid gift of William Hahn and David Root; Addgene #118018). A375 WT cells were seeded in 12-well plates with 1 million cells per well with increasing volumes of pLX_311-Cas9 lentivirus to a final volume of 2 mL with 4 µg/mL polybrene ...
-
bioRxiv - Cancer Biology 2022Quote: ... T98G Sin3B+/+ and Sin3B-/- TLR cell lines were created and then infected with lentivirus containing SceI and the template for eGFP reconstitution (Addgene #32627), after 72 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentivirus constructs were also packaged in HEK-293T cells by transient transfection of the constructs in combination with the packaging constructs psPax2 (Addgene #12260) and pMΔ2.G (Addgene #12259) ...
-
bioRxiv - Developmental Biology 2021Quote: Retrovirus for GFP labeling was produced from 293gp NIT-GFP packaging cells by transfection with pCMV-VSV-G plasmid (Addgene #8454). Viral particles with low titer of about 106 PFU/ml were used for infection ...
-
bioRxiv - Microbiology 2020Quote: ... the SLC35B2 clones have been generated into HCT116cas9 cells that are expressing mCherry and Citrine due to integration of miReporter-PGK (Addgene#82477).
-
bioRxiv - Neuroscience 2021Quote: U118-MG astrocytoma cells were transfected with the F-actin marker mCherry-LifeAct-7 plasmid (gift from Michael Davidson, Addgene #54491) using a calcium phosphate precipitation protocol.24 LifeAct-7 is a 17 amino acid peptide that binds to the actin cytoskeleton ...
-
bioRxiv - Microbiology 2021Quote: ... Jurkat cells were electroporated with the pSBbi-RP-A3 and pCMV(CAT)T7-SB100 (gift from Zsuzsanna Izsvak, Addgene plasmid #34879) [69] ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells were transfected with 500 ng of equimolar pooled SCN1A_h1b sgRNAs (Table 4) and 500 ng dCas9p300Core (Addgene, plasmid #61357) using Lipofectamine 3000 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviruses were made by Lipofectamine 2000-based co-transfection of 293FT cells with the respective lentiviral expression vectors and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lentiviruses delivering sgRNA were packed by transfecting about 70% confluent HEK293T cells cultured in T75 flasks with 5 µg pCMV-VSVG (Addgene 8454), 10 µg pCMV-dR8.2 dvpr (Addgene 8455) ...
-
bioRxiv - Systems Biology 2022Quote: Lenti vectors harboring the CRISPR/Cas9 system for Arhgdia targeting were produced by co-transfection of 293FT cells with psPAX2 (Addgene, #12260), pMD2.G (Addgene ...
-
bioRxiv - Immunology 2019Quote: ... These were packaged into a VSV-G pseudotyped lentiviral vector using HEK 293T cells expressing pMD2.G (2 ng, Addgene #12259), pCMV-DR8.2 (5 ng ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cas9 was stably infected in cell lines using a lentiviral construct encoding lentiCas9-Blast (a gift from Feng Zhang, Addgene #52962). The single-guide RNAs targeting G9a and p53 listed in Table S5 were cloned into lentiGuide-Puro (a gift from Feng Zhang ...
-
bioRxiv - Cell Biology 2019Quote: ... Cas9 was introduced into Shh-LIGHT2 cells by lentiviral transduction (Lenti-Cas9-blast; Addgene #52962; kind gift of F. Zhang, MIT) and selection with blasticidin (5 µg/ml) ...
-
bioRxiv - Molecular Biology 2020Quote: ... first pcDNA5 PURO FRT TO EGFP-AID-CENATAC was created by cloning CENATAC cDNA derived from HeLa cells into empty pcDNA5-FRT-TO-EGFP-AID (Addgene, 80075) using the cDNA PCR primers in Table S9 and digestion of both the PCR product and the plasmid with NotI/ApaI ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... approximately 500,000 cells in 6-well plates were transfected with 2000ng dCas9-KRAB-MeCP2-containing PiggyBac expression plasmids (Addgene plasmid #110821) and 400ng of transposase vector PB200PA-1 using PEI ...
-
bioRxiv - Biophysics 2020Quote: ... we generated U2OS cells stably expressing H2B fused to the HaloTag by transfection of the pBREBAC-H2BHalo plasmid (Addgene plasmid # 91564) using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Systems Biology 2019Quote: ... 350k HAP1 WT cells were seeded into a 6-well plate and 24 hours later cells were transfected with a mix of 2 µg pX459 plasmid (Addgene #62988) carrying a gRNA ...
-
bioRxiv - Systems Biology 2019Quote: The HAP1 C12orf49 gene knockout cell line was constructed by first cloning a gRNA targeting C12orf49 (Table S8) into the pX459v2 backbone (Addgene #62988), which was modified to carry the same restriction overhangs as the pLCKO vector (Addgene #73311) ...
-
bioRxiv - Genetics 2021Quote: ... 2 ml (1.5× 106/ml) cells plated in a well of a 6-well dish were transfected with 300 ng of Act::Cas9 (Addgene #62209) and the respective gRNA and repair templates for the 25C6 (75 ng pU6-3-25C6-gRNA1 (DGRC Cat# 1547) ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Cell Biology 2019Quote: Approximately 200 million HeLa cells stably expressing TAC-GFP and dCas9-KRAB fusion protein were transduced with the hCRISPRi-v2 library (Addgene #83969) at an MOI of 0.3 to ensure no more than one viral integration event per cell ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.5 million cells were resuspended in Mirus nucleofector solution and electroporated with 5 ug of px458 plasmid (Addgene plasmid #48138) containing a small guide RNA (see Table S1 for oligonucleotide information ...
-
bioRxiv - Cell Biology 2021Quote: ... Real time analysis of NFAT4-GFP nuclear translocation in response to 10 µM Cch stimulation was calculated using the equation: Quantification of ER Ca2+ store depletion and refilling was measured by transfecting parental and MCU-KO HEK293 cells with red R-CEPIA1er (Addgene: #58216) using Lipofectamine 24 hrs prior to imaging ...
-
bioRxiv - Molecular Biology 2020Quote: Generation of CRISPR knockout MEF and human cell lines were carried out as follows: Individual sgRNA (see Table S3 for sgRNA sequence) were cloned into LentiCRISPRv2 (Addgene #52961). To produce and package infectious lentivirus ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRNA gene knockdown or gene overexpression lentiviral vectors were transfected into HEK 293FT cells together with a packaging plasmid (psPAX2; Addgene; #12260) and envelope plasmid (pMD2G ...
-
bioRxiv - Cell Biology 2020Quote: Viral particles for the generation of stable overexpressed cell lines were produced by co-transfection of pLEX_307 (a gift from David Root, Addgene plasmid # 41392) containing the target gene ...
-
bioRxiv - Cell Biology 2020Quote: HAP1 wt cells as well as single cell-derived clones were obtained from Haplogen Genomics or generated in-house by transient transfection with px459 (Addgene #48139) vectors carrying sgRNAs against the selected genes ...
-
bioRxiv - Immunology 2021Quote: ... produced in HEK293FT cells transiently transfected with two packaging plasmids (psPAX2 and pMD2-G) and the lentiCRISPR v2 plasmid (Addgene #52961)11 containing a non-targeting (GGCATCTTAACTAATCGTCT ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...