Labshake search
Citations for Addgene :
2651 - 2700 of 2862 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... U-2 OS cells stably expressing the Bmal1 promoter in front of luciferase (Bmal1-luc) were generated using the pABpuro-BlucF plasmid (Addgene #46824) and maintained in 2 µg/ml puromycin (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviruses were produced by triple transfection of HEK-293T cells with the lentiviral transfer vector pLenti6.3/TO/V5-Blasti and the packaging plasmids psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Genome-wide CRISPR/Cas9 positive selection screens were performed as previously reported.51 KBM7 cells constitutively expressing Cas9 (KBM7-Cas9, 250 million) were transduced with the Brunello sgRNA library (Addgene #12260) at a multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded at 20% confluence and infected with lentivirus generated from pLentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang (41)) engineered to deliver Cas9 and a gRNA targeting LMAN1 (CCCCTTACACTATAGTGACG) ...
-
bioRxiv - Cancer Biology 2023Quote: ... as described previously.16,49 Sting knockdown in the MSI MC38 CRC cells was generated as described previously using shRNA and the pLKO.1 system.16,50 Ovalbumin (OVA) expressing MSI and CIN MC38 CRC cells were made by transfection with the pCI-neo-cOVA plasmid (Addgene #25097) and selection with 200 µg/ml G418.51
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were co-transfected with vectors the ORF3a proteins and the vector or 4xmts-Neon-Green (mitochondria; Addgene, #98876). At 48 h post-transfection ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in vivo confocal imaging was used in cells co-transfected with the FRET-based ER-ZapCY1 probe (Addgene, Catalog nr. 36321)[75] and ZnT9-50Met ...
-
bioRxiv - Genomics 2023Quote: ... 4M cells were plated in a 10cm dish for 24-hours before transfecting HEK293T cells with 9ug of dCas9-mCherry-KRAB (Addgene #60954), 4ug of packing plasmids psPAX.2 and 2ug of the envelope vector pMD2.G diluted in OptiMEM medium and Trans-Ltl transfection reagent (Mirus) ...
-
bioRxiv - Genomics 2023Quote: The A549-TetR-Cas9 cell line was created by simultaneously transfecting A549 cells with piggyBac transposase and a piggyBac cargo plasmid containing TetR-inducible Cas9 (Addgene #134247), and selecting for 7 days with 500 ug/mL G418 ...
-
bioRxiv - Neuroscience 2023Quote: ... For optogenetic activation of PRF/GlyT2+ cells we injected AAV5.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (based on Addgene plasmid #20298, UNC Vector Core) or for control AAV5.EF1a.DIO.eYFP.WPRE.hGH (based on Addgene plasmid #27056 ...
-
bioRxiv - Molecular Biology 2023Quote: 1.6 x 108 A375 cells were transduced into thirty-two 150 mm plates with lentivirus carrying The Toronto Knockout Library v3 (TKOv3, Addgene # 90294) in standard culture media + 8 µg/mL polybrene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Due to the Purmocyin resistance the XEN-dCas9-BFP-KRAB cells were infected with a modified version of the pLKO5.GRNA.EFS.PAC vector (Addgene, cat. no. 57825) replacing puromycin with blasticidin resistance ...
-
bioRxiv - Genomics 2023Quote: ... lentiviral particles encoding dCas9-BFP-KRAB were generated by transfecting HEK293T cells with plasmids encoding dCas9-BFP-KRAB (pHR-SFFV-dCas9-BFP-KRAB, Addgene 46911) and the ViraPower lentiviral packaging mix (ThermoScientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... viruses were produced in HEK 293T cells by transfecting the corresponding plasmid o interest as well as with pVSVg (Addgene, #8454) and psPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: STING1 KO HMC3 cells were generated using the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector kindly gifted by Feng Zhang (Addgene plasmid #62988)73 containing the following single guide RNA (sgRNA ...
-
bioRxiv - Systems Biology 2023Quote: The CRISPRi Calu-3 cell line was generated by lentiviral delivery of pMH0001 (UCOE-SFFV-dCas9-BFP-KRAB) (19) (Addgene #85969) into Calu-3 cells ...
-
bioRxiv - Immunology 2023Quote: ... 293T cells were co-transfected with equal amounts of this plasmid and pCas9_GFP32 (a gift from Kiran Musunuru, Addgene plasmid # 44719). GFP-positive cells were sorted after 48 hours on a MoFlo cell sorter (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dox-inducible GFP-HMGB1mut U2OS cells were generated using a previously described pPB-TetON-mEGFP-HMGB1-MUT PiggyBac transposon (Addgene #194562)39 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following day, cells were co-transfected (using Lipofectamine 3000 treatment, as described above) with pMD2.g (envelope plasmid, Addgene #12259), psPAX2 (packaging plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... 72hrs post transfection cells from both siMCU and siNT conditions were transfected with 1ug of eGFP-NFAT2 overexpression plasmid (Addgene#24219) using Lipofectamine 2000 reagent according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral particles were prepared in HEK293T cells using standard calcium-phosphate transfection of the lentivector with packaging plasmids pMD2.G (Trono lab, Addgene #12259) and pCMV-dR8.74 (Trono lab ...
-
bioRxiv - Cell Biology 2023Quote: ... The vector V2 CRISPR DNA Plasmid (1ug) was co-transfected in 293T cells along with 3 µg of the viral envelope PMD2 (Addgene # 12259) and 4 µg of the viral packing PsPAX (Addgene #12260 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Initiative for Genome Editing and Neurodegeneration core in the Department of Cell Biology at Harvard Medical School) or cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) and transfected into HEK293FT using Lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Genetics 2023Quote: ... Cells were co-transfected with Cas9-gRNA RNP complex together with the repair oligo and Puromyin-GFP plasmid39 (Addgene, Watertown, MA) using Lipofectamine Stem transfection reagent (ThermoFisher ...
-
bioRxiv - Physiology 2023Quote: ... Tracking of the plus-end side of the microtubules was performed by transiently transfecting the cells with EB3-tdTomato (Addgene #50708) 24 hours after plating following the protocol described in the previous section ...
-
bioRxiv - Microbiology 2023Quote: ... lentiviral particles pseudotyped with the VSV-G protein were produced by cotransfecting HEK293T cells in 10cm dishes with 5 mg pLentiCMVPuroDEST vector (Addgene, #17452), 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259 ...
-
bioRxiv - Microbiology 2023Quote: HPV16 PsVs were produced by co-transfecting 293TT cells with wild-type p16SheLL-3XFLAG tag [14] together with pCAG-HcRed (Addgene #11152) or pCINeo-GFP [obtained from C ...
-
bioRxiv - Molecular Biology 2023Quote: ... each cell line was given fresh growth medium and transfected with a plasmid mixture containing 1μg PB-rtTA (Addgene #126034; 22) and 1μg pUC19-piggyBac transposase 23 using Lipofectamine 3000 (Thermo Fisher L3000001) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Virus was produced in HEK293T cells (ATCC CRL-3216) by calcium phosphate co-transfection of lentiviral shuttle and packaging vectors (pRRE (Addgene #12251), pRev (Addgene #12253) ...
-
bioRxiv - Neuroscience 2023Quote: ... Neuro2a cells stably expressing the CVS-N2c glycoprotein (N2A-N2cG_02 cells) were transfected with the barcoded N2c library along with helper plasmids pCAG-N2cN (Addgene cat. # 100801), pCAG N2cP (Addgene cat ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles for cas9 and HSP90-alpha were produced using HEK293T cells by con-transfection of transgene plasmid and pMD2.G (Addgene# 12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviruses were made by Lipofectamine 2000-based co-transfection of 293FT cells with the respective lentiviral expression vectors and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: High-titre lentiviral supernatants were produced by transient transfection of 293T/17 cells with second-generation packaging/envelope vectors pRRE (Addgene #12251), pREV (Addgene #115989) ...
-
bioRxiv - Microbiology 2023Quote: ... The functionality of T7 polymerase and VSVG expression in 293FT-T7pol-VSVG cell lines was determined using pUC19-T7pro-IRES-EGFP (Addgene, 138586) or through the recovery of rVSV virus.
-
bioRxiv - Microbiology 2023Quote: ... The mouse Cul1 and Ube2l3 coding sequences were amplified from cDNA prepared from NiMOE cells and cloned into the pLenti6/V5-D-TOPO backbone (Addgene, #22945). The primer sequences used in amplifying human and mouse CUL1 and UBE2L3 coding sequences are listed in Table 1 ...
-
bioRxiv - Genomics 2023Quote: ... Lentivirus containing the landing pad sequence was produced by co-transfecting 293T cells at ∼50% confluence with psVSV-G (Addgene #12259), psPAX2 (Addgene #12260) ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral vector pLenti-CMV-Puro-DEST containing EGFP-rNLRP1-MYC was transfected into Lenti-X cells together with packaging plasmid psPAX2 (Addgene #12260) and Lentiviral envelope plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Bioengineering 2023Quote: ... Murine Stem Cell Viruses (MSCV) were packaged using Platinum-E cells by co-transfection of MSCV retroviral transfer plasmids with pCL-Eco (Addgene #12371) using X-tremeGENE 9 DNA Transfection Reagent (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Cell Biology 2023Quote: ... RAW264.7-TLR2-KO cells were generated by CRISPR-Cas9 using the LentiCRISPR-v2 system (kind gift from Dr. Brett Stringer, Addgene#98290) targeting an early PAM site in the Tlr2 coding exon ...
-
bioRxiv - Cancer Biology 2023Quote: ... integrating lentivirus for both Cas9 and sgRNA was generated by overnight transfection of adherent HEK293 cells with either the Cas9 or sgRNA vector and the packaging vectors psPax (Addgene #1226) and pMD2g (Addgene #12259) ...
-
bioRxiv - Microbiology 2023Quote: ... Puromycin selection was performed until visual inspection showed a pure population of cells express zsGreen (which is part of lentivirus backbone, see plasmid Addgene #204579). At this point all cell stored libraries were frozen until further use.
-
bioRxiv - Synthetic Biology 2023Quote: ... Lentiviral particles containing the CD19 CAR element were produced by lipofectamine-based co-transfection of HEK293 cells with 3rd generation packaging plasmids pMD2.G (Addgene, #12259), pMDLg/pRRE (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... To express the calcium indicator GCaMP6s in neuronal cell bodies or long-range projection axons either AAV5-Syn-GCaMP6s or AAV1-Syn-GCaMP6s (1−1013 gc/mL; Addgene #100843) was injected into the relevant brain region ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was generated by transfection of HEK-293T cells with lentiCRISPRv2 (sgC15, sgC40 or sgCtrl) and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: U2OS T-REx FLAG-HA-FAM134s stable and inducible cell lines were infected with lentivirus carrying the pCW57-CMV-ssRFP-GFP-KDEL (Addgene #128257). We previously deleted the tetracycline response element ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Cells were transiently transfected at 80% confluence with plasmid pcDNA3 p70/S6K2 E388 D3E (#17731; Addgene; Watertown, MA; Lee-Fruman 1999) and Lipo-3000 (#L3000001 ...
-
bioRxiv - Cancer Biology 2024Quote: ... was cloned into MSCV-IRES-KSR1-RFP and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene #8449) and CMV5-VSVG envelope construct (Addgene #8454) ...
-
bioRxiv - Cancer Biology 2024Quote: Lentivirus particles were generated in HEK293T cells following transfection with the CAR plasmid along with pMD2.G envelope (Addgene, Cat.12259) and psPAX2 packaging plasmids (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 × 106 cells were plated in 60 mm dishes for 24 hours followed by transfection with m6A-Tracer GFP (AddGene, 139403) and DAM-lamin B1 (AddGene ...