Labshake search
Citations for Addgene :
201 - 250 of 1569 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: HIS-tagged HER2 (Addgene #16257) was expressed using the Expi293™ expression system (Thermo Fisher ...
-
bioRxiv - Bioengineering 2024Quote: The Talin 1 rod domain R1-R2 (mouse talin1 482-786) was flanked between SNAP-tag (Addgene #101135) and HaloTag (Promega G8031) ...
-
bioRxiv - Molecular Biology 2023Quote: ... before using LR reaction to transfer the cDNA into destination vectors pLEX_305-C-dTAG or pLEX_305-N-dTAG (Addgene #91797 & #91798 ...
-
bioRxiv - Cell Biology 2021Quote: ... Gateway recombination of the destination vector pLVpuro-CMV-N-APEX2-EGFP with the entry clone pDONR223 LC3B WT (Addgene plasmid # 123072 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The mouse Spdef cDNA and human SPDEF cDNA were synthetized from IDT and cloned into LentiV P2A Blast (Addgene_111887) using Gibson assembly (NEB).
-
bioRxiv - Cell Biology 2021Quote: ... , (2) nlsLexA::GADfl ORF was amplified from pBPnlsLexA::GADflUw (Gerald Rubin54, Addgene-26232), and (3 ...
-
bioRxiv - Cell Biology 2020Quote: ... and Biocenter Finland) into the destination vector pDEST-V1-ORF (Addgene plasmid #73635). pDEST-swiprosin-1-V2 was generated by performing a clonase reaction between pCR8GWTopo-swiprosin-1 and pDEST-ORF-V2 (Addgene 73638) ...
-
bioRxiv - Cell Biology 2023Quote: SLC12A9-GFP was cloned by amplifying the ORF from pDONR221_SLC12A9 (Addgene plasmid #131897) and inserting it into a backbone containing GFP and a Blasticidin resistance cassette ...
-
bioRxiv - Plant Biology 2024Quote: ... The ORFs were then recombined into the bacterial expression vector pDest-527 (Addgene plasmid #11518 was a gift from Dominic Esposito ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cas7-11 ORF was PCR amplified from pDF0229- DiCas7-11 (Addgene plasmid #172506) with Q5 High-Fidelity DNA polymerase (M0491 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the Tomato ORF was amplified from a pUbC-tdTomato plasmid (Addgene #183710). Note that during cloning ...
-
bioRxiv - Cell Biology 2021Quote: ... The DYNLL1 overexpression cDNA clone expressed from a pcDNA3 vector obtained from Addgene (Plasmid #24265 (50)) was compared to an empty pcDNA3 control ...
-
bioRxiv - Cell Biology 2021Quote: The full length mouse SUMO2 fused to HA (N-terminus) from a plasmid (Addgene 48967) [67] were inserted in the retroviral transfer plasmid pCX4 Puro ...
-
bioRxiv - Cell Biology 2020Quote: ... Human ASK3 cDNA was also subcloned into pcDNA3 with a C-terminal tdTomato-tag (cDNA was gifted by M. Davidson, Florida State University, via Addgene: plasmid #54653) or pcDNA4/TO with an N-terminal Venus- or EGFP-FLAG-tag ...
-
bioRxiv - Cell Biology 2024Quote: ... a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S) (Addgene 29659, a gift from Scott Gradia) using the HiFi Assembly kit (NEB) ...
-
bioRxiv - Physiology 2024Quote: ... the AAV9-TNT-MCM2 vector was created by amplifying MCM2 cDNA from mEmerald-MCM2- N-22 (Addgene ID: 54164) using forward primer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Entry clones were recombined with MSCV-N-Flag-HA-IRES-PURO(54) (a gift from Wade Harper, Addgene plasmid # 41033) using Gateway LR Clonase II (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... the d2EGFP ORF was amplified from the pCAG-GFPd2 plasmid (#14760, Addgene, Massachusetts, USA) using the primer pair- N1142 FP (5’- CAGGAATTCGATGCTACCGGTCGCCACCATG-3’ ...
-
bioRxiv - Systems Biology 2020Quote: ... we replaced the SpCas9 open reading frame (ORF) in pLentiCRISPRv2-puro (Addgene plasmid # 98290) plasmid with an enhance green fluorescence protein (EGFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... pINDUCER21 (ORF-EG) and pINDUCER21-HOXA9 were purchased from Addgene (#46948 and #51302, respectively) (49 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ACSL4 their respective ORF were amplified from pEGFP-C1-ERalpha (Addgene, cat# 28230), pCDNA3-PRB (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: The LIG1 open reading frame (ORF) was amplified by PCR from pDONR223_LIG1_WT_V5 (Addgene, 83006) and cloned into the pOZ-FH-C vector ...
-
bioRxiv - Genomics 2022Quote: ... The SpCas9-NG ORF was subcloned from pX330-SpCas9-NG obtained from Addgene (#117919), and assembled with TEF1 promoter and CYC1 terminator (Zhang et al. ...
-
bioRxiv - Immunology 2024Quote: ... gRNA#2: ATGTTGGCTAGCTGTCGATT (Exon2 ORF bp196-215) and cloned into lentiCRISPRv1 (Addgene, plasmid 49535). After lentiviral transduction using lentiCRISPRv1 as control as described below ...
-
bioRxiv - Cell Biology 2024Quote: ... Open reading frames (ORFs) of mito-EBFP2 (a gift from Michael Davidson; Addgene #55248), EGFP-OPTN (Addgene #188784) ...
-
bioRxiv - Genomics 2024Quote: ... 1.5 µg TF ORF lentiviral plasmid was mixed with 1.125 µg psPAX2 (#12260, Addgene), 0.375 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pcDNA3.1-Flag-His-ATM (Addgene 31985), pcDNA3.1-mCherry-NLRP3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and SERPINE1-bio-his (Addgene #52077) which were gifts from Gavin Wright without signal sequence to prevent cleavage of fused proteins (75) ...
-
bioRxiv - Developmental Biology 2021Quote: pET-28b-RfxCas13d-His (Addgene #141322) plasmid containing the T7 promoter was linearized by using NotI restriction site ...
-
bioRxiv - Developmental Biology 2023Quote: ... pcDNA3.0-BMAL1-His (AddGene CN: 31367), pcDNA3.0-3XFLAG-Cry2 plasmids and PEI max 40k (Polysciences Inc CN ...
-
bioRxiv - Developmental Biology 2023Quote: pcDNA3-BMAL1-His (AddGene CN: 31367) were purchased from the Addgene ...
-
bioRxiv - Biochemistry 2024Quote: ... His-Sortase A 7M (Addgene # 51141) and GST-λ phosphatase were expressed in BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse ULK1 cDNA was isolated from a p3xFLAG-CMV14-mULK1 vector (#24301, Addgene) by PCR and cloned into the Halo-tagged pFN21A vector (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 µg of mouse Lamin B1 or Lamin B2 or Lamin B3 plasmids conjugated with myc-tag (pCS2-MT, Addgene). Cells were incubated for 48h in a DMEM cultivation medium (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... The pCAG-V5-TurboID vector was constructed by inserting the amplified TurboID cDNA containing the V5 epitope (GKPIPNPLLGLDST) sequence at the N-and C-terminal sites into the pCAGGS expression plasmid (Addgene). Expression plasmids encoding V5-TurboID-Solo and Solo-TurboID-V5 were constructed by inserting amplified Solo cDNA with a GS-linker (GGGSx2 ...
-
bioRxiv - Cell Biology 2023Quote: ... pCMV-Tag/WT M87 (Addgene #89322), pCIG2-SNAP-M87 (generated for this study from pCIG2-GFP-MACF43 by replacing GFP with SNAP-tag from pSNAPf vector (New England Biolabs ...
-
bioRxiv - Genetics 2022Quote: Human PUM1 full-length cDNA was amplified by PCR and subcloned in a pRK5 plasmid containing the Myc tag sequence (Addgene, pRK5-Myc-Parkin #17612) at the N-terminal by using SalI (New England Biolabs ...
-
bioRxiv - Biochemistry 2020Quote: ... The isolated transposed ORF was cloned into the expression vector pTKEI-Dest (Addgene Plasmid #79784) by golden gate cloning using 40 fmoles pTKEI-Dest ...
-
bioRxiv - Microbiology 2020Quote: ... the ORF was amplified from pcDNA3-myc-AIM2 (Addgene #73958, a gift from Christian Stehlik) (Khare et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... FLT3-WT and FLT3-ITD ORFs were cloned in pLEX_307 (gift from David Root (Addgene plasmid #41392 ...
-
bioRxiv - Cell Biology 2023Quote: ... The open reading freame (ORF) of EGFP was amplified from pEGFP-C2 (#6083-1, Addgene) using upstream and downstream primers located at the BstbI and XbaI cleavage sites ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Cell Biology 2020Quote: ... and 6x-HIS-tagged-HOXB2 (Addgene 8522) were obtained from commercial vendors and cloned into pCMV6 vector and transfected into HEK cells ...
-
bioRxiv - Cell Biology 2022Quote: ... and AP5Z1 cDNA was transferred by LR clonase into the pDest-53 or the pDEST-CMV-N-Tandem-mCherry-EGFP vector (Addgene #123216), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... the NINJ1 cDNA from pENTR223-NINJ1 (DNASU, HsCD00505254) and SLC7A11 cDNA from pENTR223-SLC7A11 (DNASU, HsCD00512940) were individually subcloned into pLVpuro-CMV-N-EGFP (Addgene, #122848) and pLVpuro-CMV-N-mCherry (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cDNA of the mouse KrasG12Dvariant (kindly provided by Sandra Orsulic via Addgene; #11549) and the cDNA of tdTomato (a gift from Roger Tsian ...
-
bioRxiv - Microbiology 2021Quote: ... N (Addgene # 64087), P (Addgene # 64088) ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids for expression of human His-tagged Ufd1 and tagless Npl4 were purchased from Addgene (plasmid #117107 (Ufd1-His) and #117108 (Npl4 ...