Labshake search
Citations for Addgene :
51 - 100 of 1569 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... and hTATSF1 (amplified from K562 cDNA prepared using oligo(dT) primers) ORFs respectively into pLIX_403 (Addgene # 41395). Viral preps and selection were done as in previous section ...
-
bioRxiv - Molecular Biology 2024Quote: ... LUC7L2 and LUC7L3 ORFs were amplified from human cDNA and cloned into pcDNA3.1(+)IRES GFP (Addgene #: 51406). Domain swap constructs were synthesized as gblocks from IDT and cloned into pcDNA3.1(+)IRES GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... or Notum (Gateway ORF clone ID #164485821) was clonned in frame under 7xTCF promoter (7TGC; Addgene plasmid #24304) upstream of EGFP sequence using In-Fusion HD cloning kit according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... with an N-terminal hexahistidine tag and T7 tag in pRSET plasmid was gift from was a gift from Yasushi Saeki (Addgene plasmid # 110313)46 ...
-
bioRxiv - Molecular Biology 2024Quote: ... with HA-tag at the N-terminal and GFP-tag at the C-terminal were cloned in pEGFP-N3 expression vector (Addgene #6080-1) (Table S8 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the TRIM5 ORF (#79066; Addgene) was PCR amplified and cloned into a tet-inducible lentiviral vector containing a C-terminal 3xHA tag ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Cell Biology 2024Quote: ... N-WASP cDNA was purchased from Addgene (plasmid #33019), PCR amplified and ligated into pEGFP-C1 plasmid using XhoI and EcoRI restrictions sites ...
-
bioRxiv - Biochemistry 2021Quote: ... and pGAT2 (N-terminal polyhistidine and GST tags; Addgene #112588; last three genes (61)) by Twist Bioscience ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Cancer Biology 2022Quote: ... CEBPA ORF was cloned in pINDUCER21 (ORF-EG) (gift from Stephen Elledge & Thomas Westbrook72; Addgene plasmid #46948 ...
-
bioRxiv - Biochemistry 2023Quote: ... N-terminal or C-terminal heptahistidine (His7) tags were added using pQLinkH (Addgene plasmid 13667) or a modified derivative ...
-
bioRxiv - Cancer Biology 2020Quote: ... or pDEST-ORF-v2 (Addgene, #73638) (Croucher et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... into pDEST-ORF-V2 (Addgene 73638). PDGFRα-V1 ...
-
bioRxiv - Biochemistry 2020Quote: ... the ORFs for hACE2 (Addgene#1786) and hTMPRSS2a (Addgene#53887 ...
-
bioRxiv - Pathology 2022Quote: ... D3L (amplified ORF from Addgene #35523), and a negative control sequence ...
-
bioRxiv - Pathology 2022Quote: ... D3B (amplified ORF from Addgene #66820), D3L (amplified ORF from Addgene #35523) ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611; http://n2t.net/ addgene:145611; RRID: Addgene_145611). pGBWm4046852 (coding for full- length nsp8 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584; http://n2t.net/ addgene:145584; RRID: Addgene_145584). The pET-28a-nsp9 gene was obtained from BEI Resources (NR-53501) ...
-
bioRxiv - Biochemistry 2020Quote: The MSP1E3D1 plasmid (with a His-tag as well as a TEV protease cleavage site, from Addgene, MA, USA) (26 ...
-
bioRxiv - Biochemistry 2022Quote: FUS SYQG LC containing a TEV cleavable N-terminal histidine tag (RP1B FUS LC, AddGene #127192), full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526 ...
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used the Gateway recombination system to introduce the following Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into pHAGE-TRE-DEST-NBioTAP (Addgene #53568) and pHAGE-TRE-DEST-CBioTAP lentiviral vectors (Addgene #53569) ...
-
bioRxiv - Cancer Biology 2023Quote: ... (NM_004458) Human Tagged ORF Clone (cat# RC205356) plasmids and cloned into a 3rd generation lentiviral vector PLJM1-EGFP (Addgene, cat# 19319). The control and ERBB2 OE cells were generated using retroviral vectors pBABE-puro (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... The transgene was constructed using the Gateway recombination system to introduce the Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into the pHAGE-TRE-DEST-NBioTAP (Addgene #53568) lentiviral vector ...
-
bioRxiv - Cell Biology 2021Quote: ... each into pDEST-ORF-V1 (Addgene 73637) and ...
-
bioRxiv - Neuroscience 2024Quote: ... T2A and N2cG ORFs (from Addgene #73481) into a pAM-FLEX AAV2 backbone that had been modified to replace DIO with fDIO sequences.27 PCR amplicons were generated using Q5 DNA polymerase (NEB) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the pWPI-SLC7A11 cDNA with an HA tag was obtained from Addgene (#201643). By using Gateway cloning ...
-
bioRxiv - Molecular Biology 2021Quote: ... and TopBP1 was produced as a fused protein with a GST-tag (GST TopBP1 (aa 32-1522) His from Addgene; plasmid # 20375) ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584 ...
-
bioRxiv - Biochemistry 2020Quote: FUS LC and FUS LC 12E, soluble His-tag purifications as described (Monahan et al., 2017) (Addgene ID: 98653, 98654)
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or Omphalotin A (OphA) genes with C-terminal His-tags were cloned into the UTR1-T7RNAP-T500 plasmid backbone (Catalog No. 67739, Addgene). The T7 Max promoter was further cloned into these plasmids for downstream experiments ...
-
bioRxiv - Biochemistry 2021Quote: ... P1-8 and Photobacterium damselae were cloned into pNIC28-Bsa4 (N-terminal polyhistidine tag; Addgene #26103 (60)) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cloning of Def16 sequence to pET plasmid containing an N-terminus Hisx6 tag and GFP (Addgene # 29663) was done by whole plasmid amplification using the indicated forward and reverse primers for GFP-Def16 (primers 1 and 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... the coding sequence of WIPI2d or WIPI3 was fused to a N-terminal 6xHis-TEV-mCherry-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223725; RRID:Addgene_223763). After the transformation of the pET-DUET1 vector encoding 6xHis-TEV-mCherry-WIPI2d/WIPI3 in E ...
-
bioRxiv - Biophysics 2023Quote: ... The cDNA clone for Sec61β (#49155) was obtained from Addgene, whereas the cDNA clones for Atg16L1 (BC013411 ...
-
bioRxiv - Physiology 2024Quote: UAS-Gαiact was generated from the Gαi cDNA clone (Addgene) LD22201 ...
-
bioRxiv - Molecular Biology 2021Quote: ... A1AT/ SERPINA1 and PAI1/ SERPINE1 cDNAs were amplified from SERPINA-bio-His plasmid (Addgene #52182) and SERPINE1-bio-his (Addgene #52077 ...
-
bioRxiv - Microbiology 2024Quote: ... The second crystallography construct (P1 21 1 form) was cloned into a pNIC vector with a His Sumo tag (Addgene: 215810) and residues (2 – 170 ...
-
bioRxiv - Molecular Biology 2021Quote: ... LZTR1 ORF and the pCI-backbone (Addgene, 41552) were PCR amplified and cloned using NEBuilder® HiFi DNA Assembly.
-
bioRxiv - Biochemistry 2020Quote: ... and Flag-LacZ (ORF originated from Addgene #25893), were subcloned into SmaI (NEB #R0141 ...
-
bioRxiv - Cell Biology 2022Quote: ... The iRFP ORF was PCR amplified from Addgene plasmid #45457.
-
bioRxiv - Cancer Biology 2024Quote: All ORFs were cloned into the pLX403(Addgene, #41395 puromycin resistance ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234; http://n2t.net/addgene:54234 ; RRID:Addgene_54234), while pEN435 - pCAGGS-TagBFP-hGeminin-2A-mCherry-hCdt1- rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt Tigre targeting (Addgene #9213925 ...