Labshake search
Citations for Addgene :
201 - 250 of 1122 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA-HA-14-3-3β (Addgene #13270), pcDNA-HA-14-3-3σ (Addgene #11946 ...
-
bioRxiv - Immunology 2024Quote: ... pCS2-HA-14-3-3ε (Addgene #116886), pCS2-HA-14-3-3ζ (Addgene #116888 ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA-HA-14-3-3σ (Addgene #11946) and pGEX-4T2-14-3-3 tau (θ ...
-
bioRxiv - Immunology 2024Quote: ... pCS2-HA-14-3-3ζ (Addgene #116888) and pCS2-HA-14-3-3η (Addgene #116887 ...
-
bioRxiv - Cell Biology 2020Quote: P4M-GFP and mApple-Talin-N-10 were obtained from Addgene (51469 and 54951 respectively). FAPP-GFP was a gift from Tamas Balla ...
-
bioRxiv - Cell Biology 2020Quote: ... mEmerald-N-Wasp-C-18 and mEmerald-Coronin1B from Michael Davidson (Addgene plasmids #54199, 54050), pmCherry-C1-WIP from Anna Huttenlocher ...
-
bioRxiv - Molecular Biology 2019Quote: ... as an N-terminal fusion into HSPA8 and HSPA1A pcDNA5 constructs (Addgene 19514 and 19510) to make pTP4458 and pTP4459 ...
-
bioRxiv - Cancer Biology 2019Quote: The mSMO and ShhN (Shh N-terminal domain) plasmids purchased from Addgene (#37673 and #37680). All vectors were propagated in XL10 Gold competent cells ...
-
bioRxiv - Immunology 2019Quote: ... and pcDNA3-N-FLAG-Asc (a gift from Bruce Beutler, #75134, Addgene, Watertown, MA, USA) as templates ...
-
bioRxiv - Cancer Biology 2020Quote: ... HPV16 E6 (p6661 MSCV-IP N-HA only 16E6 – Addgene plasmid # 42603 Dr. Peter Howley), HPV16 E7 (p6640 MSCV-P C-FlagHA 16E7-Kozak - Addgene plasmid # 35018 – Dr ...
-
bioRxiv - Biochemistry 2021Quote: ... pRSF-1-NMT for expression of N-myristoyl transferase in bacteria was purchased from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... AAV5-hsyn-DIO-rM3D(Gs)-mCherry (excitatory; titer: 1.3×1013 vg/mL; N=10 [Addgene, #50485 ...
-
bioRxiv - Cell Biology 2021Quote: The full length mouse SUMO2 fused to HA (N-terminus) from a plasmid (Addgene 48967) [67] were inserted in the retroviral transfer plasmid pCX4 Puro ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 5 μg of mEmerald-Kinesin11-N-18 plasmid (Addgene number: 54137) 24 hours prior to imaging ...
-
bioRxiv - Cancer Biology 2022Quote: SK-N-DZ cells were transduced with lentiviral particles encoding LRP8 gRNAs (lentiCRISPRv2 blast, Addgene plasmid #98293 was a gift from Brett Stringer) ...
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald Hc-SRC-N-18 (Src-eGFP here) was a gift from Michael Davidson (Addgene plasmid # 54118 ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Immunology 2022Quote: ... We first cloned the N- and C-termini of NFAT5 isoform A synthetized by Addgene into a pMSGV retroviral vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... The pDEST-CMV-N-Tandem-mCherry-EGFP plasmid was a gift from Robin Ketteler (Addgene plasmid #123216 ...
-
bioRxiv - Biophysics 2023Quote: ... or to the N-terminus of a glycosylphosphatidylinositol (GPI)-anchor (GPI-mEGFP, Addgene plasmid #182866) and were previously described [42 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-EF1a-N-CretrcintG and AAV1-EF1a-C-CreintG were gifts from Connie Cepko (Addgene viral prep # 69570-AAV1 and 69571-AAV1 ...
-
bioRxiv - Biochemistry 2023Quote: ... N-terminal or C-terminal heptahistidine (His7) tags were added using pQLinkH (Addgene plasmid 13667) or a modified derivative ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Systems Biology 2019Quote: ... A20-targeting guide RNAs (5’ – CACCGTTTGCTACGACACTCGGAAC – 3’, and 5’ – CACCGCTCGGAACTTTAAATTCCGC – 3’) were cloned into lentiCRISPR v2 (Addgene Plasmid #52961)48 and used for lentivirus production in HEK293T cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Cell Biology 2024Quote: ... were constructed by inserting annealed synthetic oligomers (5′-CACCgcagctcctgcctctcatcg-3′ and 5′-AAACcgatgagaggcaggagctgc-3′) into the Bbs I site of pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (#42230; Addgene, Watertown ...
-
bioRxiv - Biochemistry 2024Quote: Synthetic complementary oligos targeting POLDIP2 (5’-CACCGCGCGTCGTCGTGGTCGACGC-3’ and 5’-AAACGCGTCGACCACGACGACGCGC -3’) were cloned into PX459-SpCas9 (Addgene, (35)) at the BbsI site ...
-
bioRxiv - Developmental Biology 2021Quote: ... The following guides 5’-GGACCTGTTCGGAATCCACC-3’ and 5’-GGGTGAGGTTCTGTCTACCC-3 were separately cloned into the BbsI site of pU6-BbsI-chiRNA plasmid (obtained from Addgene) and both were simultaneously injected by Best Gene into w1118 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Developmental Biology 2019Quote: ... Two oligos encoding guide RNA sequences that targeted either exon 3 (5’-GGCTTCGACAAGGCCGAGGG −3’) or exon 4 (5’-GATCTGATCACGACGTGTTA −3’) were inserted into the BbsI site of pU6-BbSI-gRNA (Addgene). Each gRNA construct was independently injected into BDSC Stock 52669 (y1 M{vas-Cas9.S}ZH-2A w1118 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).