Labshake search
Citations for Addgene :
51 - 100 of 1122 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... and pCbh_v5 AAV-CBE N-terminal (Addgene, # 137175). Cloned vectors were validated by Sanger sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... and mEmerald-TGNP-N-10 (Addgene plasmid #54279) were gifts from Michael Davidson ...
-
bioRxiv - Microbiology 2024Quote: ... pCIG3N (N-tropic MLV gag-pol from Addgene) and pLXIN-GFP were used with Env to produce virus ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The coding sequence of N gene with the natural codon usage of SARS-CoV-2 from pSARS-CoV-2 (N) plasmid (Addgene #153201) was digested with BamHI and NotI enzymes and cloned into pEGFP-N1 using the same enzymes.
-
bioRxiv - Biochemistry 2020Quote: ... according to manufacturer’s instruction and then transferred to pLX302 lentiviral destination vector (addgene) or pDEST-CMV-N-EGFP vector (pDEST-CMV-N-EGFP was a gift from Robin Ketteler (Addgene plasmid # 122842) using recombination utilising the LR-Clonase (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Molecular Biology 2024Quote: ... A PCUP1 N-ubiquitin plasmid was constructed by amplifying the CUP1 promoter through N-ubiquitin sequence from the integrating plasmid (Addgene 131169, [56]) and gap repairing it into pRS315 linearized with BamHI ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924 ...
-
bioRxiv - Biophysics 2019Quote: ... mCherry-TOMM20-N-10 (TOMM20-mCherry, Addgene plasmid # 55146), mTagRFP-T-Mito-7 (mTagRFP-mito ...
-
bioRxiv - Biophysics 2019Quote: ... mEmerald-Nup50-N-10 (Nup50-mEmerald, Addgene plasmid #54210), mEmerald-PMP-C-10 (PMP-mEmerald ...
-
bioRxiv - Biophysics 2021Quote: ... was fused on the N-terminus of hCdt1 (Addgene #80007 ...
-
bioRxiv - Biophysics 2022Quote: ... N-terminal hexahistidine tag fused construct (Addgene plasmid #98669) with a tobacco etch virus (TEV ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus glutathione S-transferase (GST; RRID:Addgene_29707); N-terminal His6 plus small ubiquitin-like modifier (SUMO ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere; Addgene). During the same surgery ...
-
bioRxiv - Microbiology 2023Quote: ... were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223) by Gateway cloning ...
-
bioRxiv - Cell Biology 2023Quote: ... mVenus-Integrin-Beta1-N-18 plasmid (Addgene plasmid #56330) was obtained from Addgene (USA) ...
-
bioRxiv - Bioengineering 2023Quote: ... n×GCN4 sequences were derived from plasmid (Addgene #113022) via PCR ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... we used Cbh_v5 AAV-ABE N-terminal (Addgene: 137177) and Cbh_v5 AAV-ABE C-terminal (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Immunology 2024Quote: ... and pGEX-4T2-14-3-3 tau (θ) (Addgene #13281) were gifts from Michael Yaffe (Yaffe et al ...
-
bioRxiv - Neuroscience 2019Quote: ... promoter-driven AAV with mCitrine (n=44; U North Carolina vector core: AAV2-hSyn-HA-hM4D(Gi)-IRES-mCitrine) or mCherry (n=16; Addgene: AAV2-hSyn-hM4D(Gi)-mCherry ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Developmental Biology 2023Quote: ... AAVS1 TALEN-L (Addgene plasmid #59025) and AAVS1 TALEN-R (Addgene plasmid #59026 ...
-
bioRxiv - Cell Biology 2021Quote: ... pGEX6P1-N-HA (Andrew Jackson and Martin Reijns, Addgene 119756) was utilized as the backbone for recombinant protein expression E ...
-
bioRxiv - Cancer Biology 2020Quote: ... N-WASP (#54199) and fascin (#54094) were obtained from Addgene. Each insert was cloned into the lentiviral plasmid pCDH-CMV-MCS-EF1-Puro with GFP fusion protein at C-terminus.
-
bioRxiv - Neuroscience 2020Quote: ... excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry; Addgene; n = 10); and control construct (AAV5-hSyn-EYFP ...
-
bioRxiv - Microbiology 2022Quote: ... derived from a pcDNA3.1-hACE2 vector (Cat. n° 145033, Addgene), was inserted into a pLenti6.3 vector (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Fyn was amplified from mEos2-FYN2-N-10 (Addgene 57380) and assembled into pBlueScript with either a mec-4 or osm-10 promoter and the unc-54 3’UTR using the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Biochemistry 2021Quote: ... or N-terminal His6 plus green fluorescent protein (GFP; RRID:Addgene_29716). Note that in the plasmid names for this clone the numbering of Syx residues was based on the Syx isoform from NCBI Reference Sequence NP_001036128.1 ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus small ubiquitin-like modifier (SUMO; RRID:Addgene_29711); or N-terminal His6 plus green fluorescent protein (GFP ...
-
bioRxiv - Genetics 2023Quote: ... for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248) for RAD21 ...
-
bioRxiv - Molecular Biology 2023Quote: ... H-RASV12 from pBABE-Puro H-RASV12 (n°12545 Addgene) was cloned in a home-made inducible vector derived from pLVX-Tight-Puro (Clontech ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Immunology 2023Quote: ... N-MLV reporter viruses were generated by transfection of a three-plasmid system: pCIG3-N for expression N-MLV gag/pol (Addgene #132941, a gift from Jeremy Luban) [50] ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... A HeLa H2B-mCherry EmGFP-NSD3-L cell line was generated by transfecting EmGFP-NSD3-L cells with a pH2B_mCherry_IRES_puro2 plasmid (Addgene #21045) as described above ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Immunology 2021Quote: ... or 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706). Plasmids were transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: ... full name AAV-EF1a-DIO-trkB.DN-TM570-mCherry (Addgene, n°121502), was constructed by PCR amplification of rat truncated trkB.T1 with the sequence downstream of the transmembrane domain replaced by the sequence of three alanine residues followed by a stop codon (from the plasmid pLTM570 ...
-
bioRxiv - Microbiology 2021Quote: ... a pHAGE N-mNeonGreen IRES puro was also generated (Addgene #170467).
-
bioRxiv - Cell Biology 2022Quote: ... N-terminal IBAR genes were cloned into Cry2PHR-mCherry (Addgene #26866) using NheI and XhoI restriction sites (Kennedy et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-hSynapsin1::NAPA-N SV40 (gift from Baljit Khakh, Addgene #92282) (titer ...
-
bioRxiv - Neuroscience 2021Quote: ... mEos3.2-Homer1-N-18 was a gift from Michael Davidson (Addgene plasmid # 57461 ...