Labshake search

401 - 450 of 1122 citations for N BOC 3 FLUORO L TYROSINE since 2019

• STAT3 is a genetic modifier of TGF-beta induced EMT in KRAS mutant pancreatic cancer

  Stephen D’Amico, et al., bioRxiv - Cancer Biology 2023

  Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
• A genome wide CRISPR screen reveals that HOXA9 promotes Enzalutamide resistance in prostate cancer

  Michael V. Roes, Frederick A. Dick, bioRxiv - Cancer Biology 2023

  Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
• Engram cell connectivity as a mechanism for information encoding and memory function

  Clara Ortega-de San Luis, et al., bioRxiv - Neuroscience 2023

  Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
• VGLL2 and TEAD1 fusion proteins drive YAP/TAZ-independent transcription and tumorigenesis by engaging p300

  Susu Guo, et al., bioRxiv - Cancer Biology 2024

  Quote: ... or shRNAs against YAP (5’-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC -3’, cat. 27368, Addgene, pLKO1-shYAP1 was a gift from Kunliang Guan ...
• Intergenerational transport of double-stranded RNA limits heritable epigenetic changes

  Nathan Shugarts, et al., bioRxiv - Genetics 2024

  Quote: ... gfp and unc-54 3’UTR from pPD95.75 (Addgene #1494) using primers P29 and P30 ...
• USP22 controls type III interferon signaling and SARS-CoV-2 infection through activation of STING

  Rebekka Karlowitz, et al., bioRxiv - Cell Biology 2022

  Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
• A Versatile Polypharmacology Platform Promotes Cytoprotection and Viability of Human Pluripotent and Differentiated Cells

  Yu Chen, et al., bioRxiv - Cell Biology 2019

  Quote: ... The donor plasmid to insert mEGFP into the N-terminus of lamin B1 was purchased from Addgene (Cat# 87422). TrueCut Cas9 protein v2 and TrueGuide 1-piece modified synthetic gRNA (GGGGTCGCAGTCGCCATGGC ...
• TRAF6 controls spinogenesis instructing synapse density and neuronal activity through binding neuroplastin

  Sampath Kumar Vemula, et al., bioRxiv - Cell Biology 2020

  Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
• Akt1-associated actomyosin remodelling is required for nuclear lamina dispersal and nuclear shrinkage in epidermal terminal differentiation

  Clare Rogerson, et al., bioRxiv - Cell Biology 2019

  Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
• Skin epithelial cells change their mechanics and proliferation upon Snail-mediated EMT signalling

  Kamran Hosseini, et al., bioRxiv - Biophysics 2022

  Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
• Interrogation of the Dynamic Properties of Higher-Order Heterochromatin Using CRISPR/dCas9

  Yuchen Gao, et al., bioRxiv - Genomics 2021

  Quote: Individual effectors were fused at the N-terminus to the PYL1 domain (gift from Jerry Crabtree, Addgene plasmid #38247) and sfGFP ...
• Constrained G4 structures unveil topology specificity of known and new G4 binding proteins

  A. Pipier, et al., bioRxiv - Biochemistry 2021

  Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521; http://n2t.net/addgene:12521; RRID: Addgene_12521). The pLPC-puro-N-Flag-NELFE plasmid was obtained by amplification of the human NELFE cDNA (obtained from gene synthesis ...
• Proximity interactome of LC3B in normal growth conditions

  Marie Nollet, et al., bioRxiv - Cell Biology 2021

  Quote: ... Gateway recombination of the destination vector pLVpuro-CMV-N-APEX2-EGFP with the entry clone pDONR223 LC3B WT (Addgene plasmid # 123072 ...
• A microbiota membrane disrupter disseminates to the pancreas and increases β-cell mass

  Jennifer Hampton Hill, et al., bioRxiv - Molecular Biology 2022

  Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
• PIWIL1 Promotes Gastric Cancer via a piRNA-Independent Mechanism

  Shuo Shi, et al., bioRxiv - Cancer Biology 2020

  Quote: ... pGL3-U6-sgRNA-PGK-puromycin and pST1374-N-NLS-flag-linker-Cas9-D10A were gifts from Xingxu Huang (Addgene plasmid # 51133 ...
• IFT88 controls NuMA enrichment at k-fibers minus-ends to facilitate their reincorporation into mitotic spindles

  Nicolas TAULET, et al., bioRxiv - Cell Biology 2019

  Quote: ... and mEmerald-IFT88-N-18 was a gift from Michael Davidson (Addgene plasmid # 54125; http://n2t.net/addgene:54125; RRID: Addgene_54125).
• Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown Fat

  Fenfen Li, et al., bioRxiv - Physiology 2020

  Quote: ... full-length Prdm16 overexpressing plasmid with an in-frame N-terminal FLAG tag was purchased from Addgene (Addgene #15504). Full-length Dnmt1 cDNA clone was obtained from Open Biosystems and further subcloned into the pLVX lentiviral expression vector (Clontech ...
• Characterization and computational simulation of human Syx, a RhoGEF implicated in glioblastoma

  Ryan J Boyd, et al., bioRxiv - Biochemistry 2021

  Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
• Proteomic analysis identifies novel binding partners of BAP1

  Roy Baas, et al., bioRxiv - Biochemistry 2021

  Quote: ... Jürg Müller (for generation of pcDNA5.1-FRT/TO-puro-(N)GFP-TEV-FLAG-3C-BAP1) or originated from Wade Harper’s laboratory obtained from Addgene (for generation of pcDNA5-FRT/TO-puro-eGFP-BAP1) ...
• Membrane Voltage Dynamics of Parvalbumin Interneurons Orchestrate Hippocampal Theta Rhythmicity

  Hua-an Tseng, et al., bioRxiv - Neuroscience 2022

  Quote: ... PV mice (n=9) were infused with AAV9-CAG-FLEX-SomArchon-GFP (titer: 6.3×1012 – 1.1×1013 GC/mL, Addgene #126943) or AAV9-synapsin-FLEX-SomArchon-GFP (titer ...
• Membrane Voltage Dynamics of Parvalbumin Interneurons Orchestrate Hippocampal Theta Rhythmicity

  Hua-an Tseng, et al., bioRxiv - Neuroscience 2022

  Quote: ... Most CaMKII mice (n=4) were infused with AAV9-CaMKII-SomArchon-GFP (titer: 3.2×1012 GC/mL, Addgene #126942), and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer ...
• A short sequence targets transmembrane proteins to primary cilia

  Viviana Macarelli, et al., bioRxiv - Cell Biology 2024

  Quote: ... enables GFP and APEX to be targeted to cilia in many cell types via the N-terminal 203 residues of NPHP3 and was a gift from Maxence Nachury (RRID:Addgene_73186) (Mick et al ...
• Ventral pallidum projections to the ventral tegmental area reinforce but do not invigorate reward-seeking behavior

  Dakota Palmer, et al., bioRxiv - Neuroscience 2023

  Quote: ... Rats intended for fiber photometry experiments (n=11 females) received unilateral infusions of AAV9 FLEX-GCaMP6f (0.4uL, titer ∼1.4 × 1013 GC/mL, Addgene #100833) into the VP and retro-AAV Cre (0.4uL ...
• Selenocysteine tRNA methylation promotes oxidative stress resistance in melanoma metastasis

  Leona A. Nease, et al., bioRxiv - Cancer Biology 2023

  Quote: ... and WDR6 (N-6xHis) coding sequences were codon-optimized for e.coli bacteria and cloned separately into petDuet-1 (purchased from Addgene) using the NcoI site downstream of the first T7 promoter ...
• Control of mitophagy initiation and progression by the TBK1 adaptors NAP1 and SINTBAD

  Elias Adriaenssens, et al., bioRxiv - Cell Biology 2023

  Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
• Control of mitophagy initiation and progression by the TBK1 adaptors NAP1 and SINTBAD

  Elias Adriaenssens, et al., bioRxiv - Cell Biology 2023

  Quote: ... Human NDP52 cDNA was cloned into a pGST2 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_187828). After the transformation of the pGST2 vector encoding GST-TEV-NDP52 in E ...
• Control of mitophagy initiation and progression by the TBK1 adaptors NAP1 and SINTBAD

  Elias Adriaenssens, et al., bioRxiv - Cell Biology 2023

  Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
• How a disordered linker in the Polycomb protein Polyhomeotic tunes phase separation and oligomerization

  Tim M. Gemeinhardt, et al., bioRxiv - Biochemistry 2023

  Quote: ... Linker SAM variants with N terminal HisSUMO-tag were assembled in a pET vector (starting from Addgene Plasmid #111559) for recombinant expression in E ...
• Control of mitophagy initiation and progression by the TBK1 adaptors NAP1 and SINTBAD

  Elias Adriaenssens, et al., bioRxiv - Cell Biology 2023

  Quote: ... from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870). For expression of unlabeled NAP1 in E ...
• Control of mitophagy initiation and progression by the TBK1 adaptors NAP1 and SINTBAD

  Elias Adriaenssens, et al., bioRxiv - Cell Biology 2023

  Quote: ... and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871), NAP1 delta-NDP52 (S37K/A44E ...
• Large-scale discovery of recombinases for integrating DNA into the human genome

  Matthew G. Durrant, et al., bioRxiv - Bioengineering 2021

  Quote: ... with 1000 ng of reporter and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
• From mec cassette to rdhA: a key Dehalobacter genomic neighborhood in a chloroform and dichloromethane–transforming microbial consortium

  Olivia Bulka, et al., bioRxiv - Microbiology 2024

  Quote: ... such that gene could be inserted by Gibson Assembly into p15TV-L (Addgene #26093) linearized by BseRI digestion to produce the expression vector p15TVL-AcdA ...
• ANKLE1 cleaves mitochondrial DNA and contributes to cancer risk by promoting apoptosis resistance and metabolic dysregulation

  Piotr Przanowski, et al., bioRxiv - Cancer Biology 2022

  Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
• A cis-regulatory element promoting increased transcription at low temperature in cultured ectothermic Drosophila cells

  Yu Bai, et al., bioRxiv - Cell Biology 2020

  Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
• Genome-wide, bidirectional CRISPR screens identify mucins as critical host factors modulating SARS-CoV-2 infection

  Scott B. Biering, et al., bioRxiv - Genetics 2021

  Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
• Spinal premotor interneurons controlling antagonistic muscles are spatially intermingled

  Remi Ronzano, et al., bioRxiv - Neuroscience 2022

  Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
• Lysosomal retargeting of Myoferlin mitigates membrane stress to enable pancreatic cancer growth

  Suprit Gupta, et al., bioRxiv - Cancer Biology 2021

  Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
• Functionally linked amygdala and prefrontal cortical regions are innervated by both single and double projecting cholinergic neurons

  Bence Barabás, et al., bioRxiv - Neuroscience 2023

  Quote: ... we injected 3×100 nl AAV5.Ef1a.DIO.eYFP (Penn Core, Addgene: 27056) into the mPFC (AP/ML/DV coordinates 2.2 ...
• Heterogeneous Receptor Expression Underlies Non-uniform Peptidergic Modulation of Olfaction in Drosophila

  Tyler R. Sizemore, et al., bioRxiv - Neuroscience 2023

  Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
• Reduced histone gene copy number disrupts Drosophila Polycomb function

  Jeanne-Marie E. McPherson, et al., bioRxiv - Genetics 2023

  Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
• Conservation and divergence of regulatory architecture in nitrate-responsive plant gene circuits

  C Bian, et al., bioRxiv - Plant Biology 2023

  Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
• Assessment of the Effects of Environmental Perturbations on Soil Ecology in A Terrestrial Mesocosm

  Kathleen L. Arnolds, et al., bioRxiv - Microbiology 2023

  Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
• Protein-mediated genome folding allosterically enhances site-specific integration of foreign DNA into CRISPRs

  Andrew Santiago-Frangos, et al., bioRxiv - Biochemistry 2023

  Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
• Identification of a global gene expression signature associated with the genetic risk of catastrophic fracture in iPSC-derived osteoblasts from Thoroughbred horses

  Esther Palomino Lago, et al., bioRxiv - Genetics 2024

  Quote: ... along with 3 µg of pMXs.hOct4 (Octamer-Binding Protein 4, RRID:Addgene_17217), pMXs.hSox2 (SRY-Box Transcription Factor 2 ...
• Emergence of glycogen synthase kinase-3 interaction domain enhances phosphorylation of SARS-CoV-2 nucleocapsid protein

  Jun Seop Yun, et al., bioRxiv - Cell Biology 2022

  Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
• A transgenic zebrafish line for in vivo visualisation of neutrophil myeloperoxidase

  Kyle D Buchan, et al., bioRxiv - Immunology 2019

  Quote: ... The MPO-mEmerald gene was incorporated into an expression vector by first digesting the mEmerald-MPO-N-18 plasmid (Addgene plasmid #54187 ...
• PARG inhibition induces replication catastrophe in ovarian cancer cells with down-regulated DNA replication genes

  C. Coulson-Gilmer, et al., bioRxiv - Cancer Biology 2020

  Quote: ... modified to express human histone H2B tagged at the N-terminus with GFP (pLVX-myc-EmGFP-H2B) plus psPAX2 and pMD2.G (gifts from Didier Trono, Addgene) using 16.6 mM CaCl2 in DMEM supplemented with 10% Hyclone™ serum (GE Healthcare ...
• Increased Dynamics of α-Synuclein Fibrils by β-Synuclein Leads to Reduced Seeding and Cytotoxicity

  Xue Yang, et al., bioRxiv - Biophysics 2019

  Quote: Expression of N-terminally acetylated human αS and βS proteins was performed via co-expression with pNatB plasmid (Addgene #53613) in E ...
• Direct quantification of ligand-induced lipid and protein microdomains with distinctive signaling properties

  Daniel Wirth, et al., bioRxiv - Biophysics 2021

  Quote: The construct for the adaptor protein mTurquoise-SRC-N-18 (SRC with mTurquoise fused to its C-terminus via a linker) was a gift from Michael Davidson (Addgene plasmid # 55560 ...
• The biomedical sensor Cell-Fit-HD^4D, reveals individual tumor cell fate in response to microscopic ion deposition

  M Niklas, et al., bioRxiv - Cancer Biology 2020

  Quote: ... A549 cells were retrovirally transduced with a construct coding for the N-terminus of 53BP1 fused to the sequence coding for fluorescent mCherry-protein (Addgene Catalog # 19835 ...