Labshake search
Citations for Addgene :
151 - 200 of 1122 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Dapi labelled the nuclei and m-Cherry-TNGP-N-10 (Addgene, Cat # 55145) localized the Golgi ...
-
bioRxiv - Cell Biology 2022Quote: ... The MAP4K4 sequence was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentiviral plasmid using the gateway system ...
-
bioRxiv - Microbiology 2023Quote: ... The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene) with primers HCoV-OC43-N c-opt(pLVX)_Fw (gaattcgccgccaccatgtccttcaccccggg ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... The LMP1 coding region was amplified from MSCV-N LMP1131 (Addgene plasmid #37962) and cloned into pRetroX-IRES-ZsGreen via Gibson Assembly ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μg pMD2.G (Addgene #12259), 12 μg pCMV delta R8.2 (Addgene #12263) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-ER-3 (Addgene plasmid #54082), and calnexin-mEmerlad (Addgene plasmid #54021 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μg psPax vector (Addgene #12260), 1.5 μg pMD2.G vector (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFJ104 (Pmyo-3::mCherry, Addgene #19328) and pGH8 (Prab-3::mCherry ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 µg pMD2.G (Addgene #12259) and 9 µg lentiviral vector were diluted in 1.2 mL OptiMEM ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg of psPAX2 (Addgene #12260), and 1.5 µg of the pMD2.G plasmid (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Biochemistry 2022Quote: ... This was cloned into p15TV-L (AddGene ID: 26093) under the T7 promoter in-frame with the N-terminal 6xHisTag ...
-
bioRxiv - Genetics 2020Quote: ... and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Developmental Biology 2022Quote: ... pCXLE-L-MYC-F2A-LIN28 (ML, Addgene ID 27080), pCXLE-hOCT4-shTP53 (Addgene ID 27077) ...
-
bioRxiv - Genetics 2023Quote: ... by co-transfecting cells with TALEN-L (Addgene #35431), TALEN-R (Addgene #35432 ...
-
bioRxiv - Systems Biology 2023Quote: ... and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Biochemistry 2019Quote: ... and pFLAG-SREBP2Nt (N-terminal transcriptionally active domain, amino acids 1-482) (Addgene, 26807) were used to transfect cells (HEK293) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pDEST-CMV-N-mCherry was a gift from Robin Ketteler (Addgene plasmid # 123215) (Agrotis ...
-
bioRxiv - Neuroscience 2021Quote: ... and tTA from pAAV::TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Addgene #92392) by the conventional PCR reactions ...
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were AAV5-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Addgene plasmid #92392), AAV5-M13-TEV-C-P2A-tdTomato (Addgene plasmid #92391) ...
-
bioRxiv - Biochemistry 2021Quote: ... and pGAT2 (N-terminal polyhistidine and GST tags; Addgene #112588; last three genes (61)) by Twist Bioscience ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLVU/GFP and pLEX_305-N-dTAG lentiviral plasmid vectors were from Addgene (#24177, #91797). pHTN HaloTag CMV-neo and pHTC HaloTag CMV-neo vectors were from Promega (G7721 ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received infusions of 500 nL of AAV5-hsyn-ChR2-eYFP (n= 22; Addgene 26973 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21(DE3) expression strains containing GST-Hsp90 N(9–236) plasmid (Addgene: 22481) were grown in 1 l LB media supplemented with 100 μg/ml ampicillin at 25 °C and shaking (200 r.p.m. ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plasmid px330- BbsI-PITCh UPF1 N is based on pX330-BbsI-PITCh (Addgene plasmid #127875 ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two guide RNA sequences were selected to target exon 1 of mtIF3 as described previously (5′-GCAAUAGGGGACAACUGUGC-3′ and 5′-GCAGAGUAUCAGCUCAUGAC-3′) 59 and cloned into the pL-CRISPR.EFS.GFP (a gift from Benjamin Ebert, Addgene plasmid # 57818 ...
-
bioRxiv - Neuroscience 2024Quote: ... containing AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837 (44)) and AAV9-CAMKII-mScarlet-C1V1-KV2.1 (Addgene ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μg pMD2.G (Addgene, #12259) into 293T cells cultured in 100 mm dish ...