Labshake search
Citations for Addgene :
1951 - 2000 of 2007 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... cells at 80-90% confluence were transfected with 2.5-5 µg of plasmid DNA (pcDNA3-EGFP-Cdc42-wt, Addgene #12975) or 50-100 nM siRNA (CdGAP Smart pool or Cdc42 siRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus particles for CRISPR-dCas9-directed knockdown of b2m were generated after subcloning a 20 nt sequence (5’ GCC-GTC-GGG-AAG-GAG-AAC-TA-3’ against the 5’- UTR of b2m into pLV-hU6-sgRNA hUBC-dCas9-KRAB-T2a-Puro (gift from Charles Gersbach, Addgene plasmid # 71236 ...
-
bioRxiv - Cancer Biology 2024Quote: 5 x 106 B-ALL cells (NALM6, REH or SUP-B15) were transduced with lentivirus expressing IKZF1 specific (Addgene #69041) or scramble (Addgene #69040 ...
-
bioRxiv - Cell Biology 2020Quote: ... NuMA-N-PhusionRed-LOV2 and EGFP-Zdk1-NuMA-C were subcloned into a Moloney murine leukemia retroviral plasmid (gift from Iain Cheeseman; pIC291, Addgene #51403 (Welburn et al., 2009)) ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by ligation in place of the mApple sequence in the mApple-CD36-C-10 vector (plasmid # 54874, Addgene, Watertown, MA (Githaka et al., 2016)) ...
-
bioRxiv - Cell Biology 2020Quote: ... using primer sequences 5’-TGTACCGGTCTCGAGGCCACCAT-GGTGGGTGAGG and 5’-AGATCCGGAGCTGTG-CCCCAGTTTGCTA, and cloned in place of EGFP in pT7-EGFP-C1-HsDCP1a (Tritschler et al., 2009) (Addgene # 25030). We then excised the FP635-DC-P1a cassette and blunt cloned into d2EGFPβ-glo-bin-UTR in place of the d2EGFP coding region.
-
bioRxiv - Molecular Biology 2020Quote: ... All cell lines used to assess mitotic progression (Figures 5 and S7) were generated by co-transfecting pcDNA3 encoding mCherry-tagged Histone H2B (Addgene: 20972) and pcDNA3 encoding GFP-tagged Lamin B1 (a kind gift from David Vaux) ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN glia AAV-5: pZac2.1 gfaABC1D-cyto-GCaMP6f at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 sgRNAs targeting DIS3L2 (generated using the ChopChop tool (Labun et al., 2019)) were cloned into lentiGuide-Puro (Addgene #52963). The individual sgRNAs were subsequently transduced into MCF10a cells stably expressing pHR-SFFV-dCas9-BFP-KRAB (Addgene #46911 ...
-
bioRxiv - Microbiology 2021Quote: Chemical-genetic screens were initiated by thawing 5 × 1 mL (1 OD600 unit per mL) aliquots of the Mtb CRISPRi library (RLC12; Addgene #163954) and inoculating each aliquot into 19 mL 7H9 supplemented with kanamycin (10 μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Cell Biology 2022Quote: ... a 20bp guide sequence targeting the 5’ end of WNK1 exon 1 was ligated to the BbsI site of PX459 (Addgene #62988). In addition ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Developmental Biology 2022Quote: ... Lentiviruses delivering sgRNA were packed by transfecting about 70% confluent HEK293T cells cultured in T75 flasks with 5 µg pCMV-VSVG (Addgene 8454), 10 µg pCMV-dR8.2 dvpr (Addgene 8455) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Microbiology 2021Quote: Design of the guide RNA targeting the region between Dicer 5’-UTR and its first coding exon for CRISPR/Cas9 mediated knock-in was carried out using the CRISPOR Design Tool [86]. Annealed oligonucleotide corresponding to the gRNA (Supp. Table 5) were cloned into the vector pX459 (Addgene #48139) which also encodes S ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.5 million cells were resuspended in Mirus nucleofector solution and electroporated with 5 ug of px458 plasmid (Addgene plasmid #48138) containing a small guide RNA (see Table S1 for oligonucleotide information ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with a combination of three plasmids: 5 μg of pMD2.G (gift from Didier Trono, Addgene plasmids #12259), 15 μg of psPAX2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Neuroscience 2023Quote: ... 2014) AAV2-hSyn-DIO-hM4D(Gi)- mCherry vector (titer ≥ 5×10¹² vg/mL) was attained from AddGene (catalog number 44362-AAV2). Rats were anesthetized with 2.5% isoflurane ...
-
bioRxiv - Genomics 2023Quote: ... a plasmid encoding a sgRNA that targets the 5’ coding sequence of bc10 (GP01409) was co-injected with pCRISPaint-T2A-Gal4-3xP3-RFP (Addgene #127556) into nos-Cas9attP40 embryos ...
-
bioRxiv - Neuroscience 2023Quote: ... were coated with 200 nL of a 1:1 mixture of 5% silk fibers and AAV9.CaMKII.GCaMP6f.WPRE.SV40 (Addgene viral prep # 100834-AAV9), as previously described by 70 ...
-
bioRxiv - Neuroscience 2024Quote: ... two 5 weeks old rats habituated to tickling underwent unilateral injection of 100 nl at 30 nl/min of AAV2/5.hsyn.eGFP (Addgene, 50465-AAV5) in the insular cortex at the following coordinates ...
-
bioRxiv - Genomics 2024Quote: ... respectively),25 modified scaffold sequence was 5′GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGC,60 and RNA structural motif for epegRNAs was tevopreQ1 (5′-CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA).40 pegRNAs and epegRNAs used the pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955)35 backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... Two gRNA spacer sequence targeting the 5’UTR immediately before the start codon of gcm were first cloned into pAC-U63-tgRNA-nlsBFPnls (Addgene 169029) (78 ...
-
bioRxiv - Cell Biology 2023Quote: The PM-targeting sequence MyrPalm was amplified by PCR and ligated at the 5’ of the cameleon D1cpv-encoding sequence (Addgene #37479) into pcDNA3.
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Plant Biology 2023Quote: ... and MOM1 CMM2 domain (aa1660-aa1860)5 were first cloned into gateway entry vectors followed by LR reaction with pGBKT7-GW (Addgene 61703) and pGADT7-GW (Addgene 61702 ...
-
bioRxiv - Plant Biology 2023Quote: ... The construct contains a Cas9 expression cassette driven by the CaMV 2×35S promoter and 5’UTR and guide RNA (Ueta et al. 2017) scaffold driven by the AtU6 promoter (Kamoun Lab, Addgene #46968). The AtU6-gRNA-7xT fragment was cloned into level-1 plasmid (SlIAA9-gRNA3 ...
-
bioRxiv - Microbiology 2023Quote: ... lentiviral particles pseudotyped with the VSV-G protein were produced by cotransfecting HEK293T cells in 10cm dishes with 5 mg pLentiCMVPuroDEST vector (Addgene, #17452), 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells with lentiviruses of I-SceI or Cas9WT or Cas9D10A along with gRNA (5’-GTAGGAATTCAGTTACGCT) from the Cas9WT vector derived from lentiCRISPR V2 (Addgene, #52961) or the Cas9D10A vector 19 ...
-
bioRxiv - Cancer Biology 2024Quote: 293T cells (1.5 x 106 cells in a 10-cm dish) were transfected with the pCDH-puro-CMV-VC3AI lentiviral vector (Addgene, 78907) using Lipofectamine 2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... 50 nl of adeno-associated viruses (pAAV-hSyn-DIO-EGFP at titer 1,5 x 10*8; Addgene 50457-AAVrg or retrograde hSyn-DIO- mCherry at titer 3,75 x 10*8; Addgene 50459-AAVrg) were stereotactically injected into the CeA (coordinates from bregma ...
-
bioRxiv - Genetics 2024Quote: ... with an HA-tag sequence fused to its 5’ end was cloned into a PiggyBac vector (pPB-CAG-3xFLAG-empty-pgk-hph, Addgene, #48754) to create pPB-CAG-3xFLAG-HA-PATZ1-pgk-hph plasmid via Gibson assembly (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: The MCS of pBAD24 (Guzman et al., 1995) was exchanged for the red fluorescent protein (RFP) cassette from pPGC-C (Addgene plasmid # 174580,(Bentham et al., 2021)) flanked by BsaI restriction sites ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral vectors expressing the cDNA of wild-type c-Myc and GFP in the murine stem cell virus backbone were purchased from Addgene (MSCV-Myc-IRES-GFP, Plasmid #18770). Doxycycline-inducible constructs were obtained by cloning c-Myc cDNA into GC385-S backbone ...
-
bioRxiv - Biochemistry 2024Quote: ... Ttyh1 was expressed from a pLX304 vector after addition of C-terminal Strep and His tags to an existing construct (Addgene #161676, a gift from Mike McManus). To stably express fluorescently tagged Prom1 WT and W795R variants in HeLa cells for live cell imaging ...
-
bioRxiv - Developmental Biology 2020Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... 2012), and followed by an eGFP-containing 5’ UTR (pGH112, Erik Jorgensen) in the destination vector pCFJ150 (Erik Jorgensen, Addgene plasmid #19329). The GCaMP6f-containing plasmid (Prig-3::GCaMP6f::unc-54 ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Developmental Biology 2021Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1ug of either SF3B1 sgRNA or Rosa26 sgRNA in pLKO.5 Puro-2A-GFP backbone was co-transfected with either 1ug of NG-ABE8e (Addgene plasmid 13849) or NG-ABEmax (Addgene plasmid 124163) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Plant Biology 2024Quote: ... the AtTRXh5 and OsHIPP43-HMA level 0 modules were cloned into the level 1 binary acceptor plasmid pICH47732 with pICSL13001 (long 35s CaMV promoter + 5’ untranslated leader, Addgene no. 50265), pICSL30009 (4xMyc N-terminal tag ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... A previously published plasmid (Brunet et al., 2021) encoding the pEFL-pac-5’Act cassette was used as a template (Addgene ID NK802). Custom primers were designed to add an 18-nucleotide premature termination cassette (5’-TTTATTTAATTAAATAAA-3’ ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...