Labshake search
Citations for Addgene :
1601 - 1650 of 2007 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type and mutant SpCas9 (1-1,368) possessing a C-terminal decahistidine tag (Addgene, no. 62731) was expressed and purified as described previously (35) ...
-
bioRxiv - Biophysics 2020Quote: ... Two plasmids containing full-length untagged Npl4 and C-terminal His-tagged Ufd1 were purchased from Addgene. Npl4 fragments were expressed in pET-28a vector with an N-terminal His-SUMO tag ...
-
bioRxiv - Developmental Biology 2021Quote: ... AAAC-CCTGAGCAGAAGAGTGGTTA-C) were designed and ligated into the RNA-guided nuclease plasmid (pX330-mCherry plasmid; Addgene), in order to induce the Cas9-mediated DSB in the genomic DNA of the Dystrophin-deficient iPSCs ...
-
bioRxiv - Biophysics 2021Quote: ... GFP was fused to the C-termini of the SpyCatcher sequence subcloned in pDEST14 (Addgene plasmid # 35044) and expressed in E.coli BL21 (DE3) ...
-
bioRxiv - Cell Biology 2023Quote: cDNA sequences encoding N- and C-terminal fragments of Venus were amplified from pCe-BiFC-VN173 (Addgene) and pCe-BiFC-VC155 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... For C-terminal tagging a homology directed repair donor plasmid containing mClover3 (derived from Addgene plasmid 72829), followed by 24xMS2V5 33 was created ...
-
bioRxiv - Cell Biology 2024Quote: ... CAPS-gfp was created by Gateway cloning the CAPS gene into pDEST-CMV-C-EGFP (Addgene #122844), to create an C-terminally-tagged gfp construct under control of the cmv promoter.
-
bioRxiv - Genetics 2024Quote: ... and blue fluorescent protein (tagBFP) with a KRAB domain at the C-terminus (Addgene 167981; Figure 1A)14 ...
-
bioRxiv - Biophysics 2024Quote: ... pcDNA3-Antares2 c-myc (a gift from Huiwang Ai; Addgene plasmid # 100027; http://n2t.net/addgene: 100027; RRID:Addgene_100027)94 and pmScarlet_C1 (a gift from Dorus Gadella ...
-
bioRxiv - Cell Biology 2024Quote: ... and the C-terminus of YAP containing the transcription activation domain (TAD) or VP64 subcloned from Addgene plasmid # 61422 ...
-
bioRxiv - Cell Biology 2024Quote: ... mCherry-Trim21 cRNA (M. musculus domesticus Trim21 fused with mCherry at the C-terminus, Addgene cat# 105522) at 800 ng/µl and normal rabbit IgG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453; a gift from Bob Weinberg) (Stewart et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... one group of animals (n=6) received a bilateral injection of a virus driving expression of the calcium indicator GCaMP7s (AAV9-hSyn-GCaMP7s-WPRE; Addgene; 300nL per side) targeting the CA1v at the following stereotaxic coordinates ...
-
bioRxiv - Cancer Biology 2021Quote: ... we cloned Myc-FLAG tagged POT1 into T7 expression vector (pcDNA 5/FRT, Addgene) and performed site-directed mutagenesis ...
-
bioRxiv - Cancer Biology 2021Quote: mRFP-FKBP-5-ptase-dom and PM-FRB-CFP plasmids were obtained from Addgene (deposited by the laboratory of T ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell line carrying the 5’TOP element-containing SunTag reporter (Addgene plasmid #119946) together with scFv-GFP and NLS-stdMCP-stdHalo was described previously (Wilbertz et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl cold lysisg/μl cold lysisl pCAGG>nls-hCas9-nls-GFP (Addgene #99141) and 3 μl cold lysisg/μl cold lysisl U6.3>Lhx5/Sox1/Six3 gRNA f+e was microinjected together with the Fast Green solution (Sigma ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the sequence of Francisella novicida cas12a was amplified from pUDC175 (Addgene plasmid #103019, (5)) using primers 13553-13554 ...
-
bioRxiv - Molecular Biology 2020Quote: The hCRIPSRi-v2 library top 5 sgRNAs/ gene (Horlbeck et al. 2016)(Addgene # 83969), was a gift from the Jonathan Weissman lab at UCSF ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Genomics 2023Quote: K562 CRISPRi cells were transduced with the hCRISPRi-v2 top 5 library (Addgene #83969)138 with 840X representation ...
-
bioRxiv - Cancer Biology 2024Quote: ... libraries with 5 sgRNAs per gene (mCRISPRi-v2; the “top5” library from Addgene #1000000092) or 10 sgRNAs per gene (hCRISPRi-v2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 x 106 HEK293T cells were co-transfected with 5μg psPAX2 (Addgene, Plasmid # 12260), 5μg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The FUCCI adenoviral vector was generated by cloning tFucci(CA)5 (Addgene plasmid #153521) into the pShuttle-CMV vector ...
-
bioRxiv - Neuroscience 2023Quote: ... an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) or a control virus (AAV2-hSyn-DIO-EGFP ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1, Addgene, 1×10¹³ vg/mL) was made into the craniotomy ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (gifted from Melina Fan [Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964]), pAAV2/7 (gifted from James M ...
-
bioRxiv - Immunology 2024Quote: ... Two BA.5 NTD DMS libraries were further assembled into pETcon 2649 vector (Addgene) and electroporated into electrocompetent DH10B cells for plasmid amplification ...
-
bioRxiv - Neuroscience 2024Quote: ... a backbone plasmid of pLV.PARP1#5 (a gift from Didier Trono - Addgene plasmid # 14548), to produce pLV.Usp14shRNA ...
-
bioRxiv - Biophysics 2024Quote: ... 5 μg of pMD2.G envelope plasmid (Addgene #12259, generated in Dr Trono’s lab) and 2.5 μg of pRSV-Rev plasmid (Addgene #12253 ...
-
bioRxiv - Cancer Biology 2024Quote: 10 µg of the expression plasmid and 5 µg pCL-Eco (Addgene plasmid #12371) were co- transfected into Pheonix-Eco cells in the culture medium without antibiotics ...
-
bioRxiv - Microbiology 2020Quote: Lentivirus-derived VLPs were produced by transfecting 10 cm dishes of HEK293T LentiX cells with lentiviral packaging plasmids encoding Gag/Pol (pMDLg/pRRE, 15 µg) and Rev (pRSV-REV, 6 µg) (Addgene plasmids 12251 and 12253) together with vectors expressing SARS-CoV-2 Spike (13 µg ...
-
bioRxiv - Molecular Biology 2020Quote: ... into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (C-terminal tag) using InFusion cloning (Addgene #138440). Full-length UL87 was PCR amplified from HCMV Towne BAC DNA with primers to introduced EcoRI and XhoI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid expressing the human ACE2 protein with a C-terminal C9 tag was obtained from Addgene (Plasmid 1786). 293T cells were transduced with retroviral particles carrying a pQCXIP vector encoding the gene for the human ACE2 protein ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into the pPD95.77 vector (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sirius-H2B-C-10 (injected as marker for CDH11MO) was a gift from Michael Davidson to Addgene (Addgene plasmid # 55226 ...
-
bioRxiv - Cell Biology 2020Quote: ... mEmerald-Sec61-C-18 was a gift from Michael Davidson (deceased, formerly Florida State University, Tallahassee, FL; Addgene plasmid # 54249 ...
-
bioRxiv - Cancer Biology 2021Quote: ... pBabe-puro plasmids containing human C/EBPB LAP2 and LIP isoforms were from Addgene (Cat.# 15712 and 15713).
-
bioRxiv - Cancer Biology 2021Quote: ... or RUNX1ΔEx6 were ligated into XhoI/EcoRI restriction sites in the c-Flag pcDNA3vector (Addgene plasmid #20011; http://n2t.net/addgene:20011; RRID:Addgene_20011) (Sanjabi et al. ...
-
bioRxiv - Immunology 2022Quote: ... pCAGGS-SARS2-S-FKO (C-flag) was a gift from Hyeryun Choe & Michael Farzan (Addgene plasmid # 159364; http://n2t.net/addgene:159364; RRID:Addgene_159364). After 48 hours ...
-
bioRxiv - Cancer Biology 2020Quote: cDNAs for human prostate cancer TMPRSS2-ERG fusion was cloned into retroviral-based vector MSCV-C-HA (Addgene). Retrovirus was produced in 293T cells by standard methods using Ampho packaging vector ...
-
bioRxiv - Molecular Biology 2021Quote: Human Δ43GTPBP6 was cloned into the pET-derived vector 14-C (gift from Scott Gradia; Addgene plasmid #48309; http://n2t.net/addgene:48309; RRID:Addgene_48309) via ligation-independent cloning (primer sequences ...
-
bioRxiv - Immunology 2020Quote: mApple-Dectin1A-C-10 was a gift from Michael Davidson (Addgene plasmid # 54883; http://n2t.net/addgene:54883; RRID:Addgene_54883). pEGFP-DC-SIGN was a generous gift from Ken Jacobson[12] ...
-
bioRxiv - Cell Biology 2020Quote: ... the cDNA of human CAV1 was PCR amplified from the mammalian expression plasmid Emerald-CAV1 C-10 (Addgene No ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 54967; http://n2t.net/addgene:54967; RRID:Addgene_54967).
-
bioRxiv - Molecular Biology 2021Quote: ... and miRFP2 genes were PCR amplified and swapped with mClover2 in pmClover2-tubulin-C-18 plasmid (Addgene #56376) and with TagRFP675 in pTagRFP675-actin-C1 (Addgene #44277 ...
-
bioRxiv - Genomics 2023Quote: ... FKBP12F36V-mNeonGreen-V5 (for C-terminal tagging) was amplified from pAAV-hSOX9-dTAG-mNeonGreen-V5 (Addgene plasmid #194971).
-
bioRxiv - Molecular Biology 2023Quote: ... The amplicons were subsequently combined with a level 0 C-terminal 6xHis tag module pICSL50025 (Addgene plasmid # 174589) and either pOPARA1 ...
-
bioRxiv - Genomics 2023Quote: ... was performed at 50 °C with a mixture of Bsp119I-digested Lenti-Neo-iCas9 (Thermo FD0124; Addgene #85400), dCas9-KRAB-MeCP2-T2A amplicon ...
-
bioRxiv - Cancer Biology 2024Quote: ... mRFP with a C-terminal KDEL sequence (ER-mRFP) was PCR amplified out of ER-mRFP (Addgene, 62236) using the forward primer 5’-GGTCGGATCCGCCGCCACCATGGACAGCAAAGG-3’ and the reverse primer 5’-GAGGCACCGGTGTTTAGAGCTCATCTTT-3’ ...