Labshake search
Citations for Addgene :
1751 - 1800 of 2007 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... membrane-trafficking optimized variant was generated by fusing an additional trafficking signal from the potassium channel Kv2.112 to the C-terminus of Chrimson (pAAV-hSyn-somBiPOLES-mCerulean; Addgene #154945). For expression in GABAergic neurons ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...
-
bioRxiv - Biochemistry 2021Quote: ... Vector pREXNH3CA used to clone EfrCD in frame with a C-terminal Avi-tag was constructed from pREXNH3 (Addgene #47079) by PCR amplification with 5’ phosphorylated primers pREXNH3(newAvi_5’P)_FW (5’-aga aaa tcg aat ggc acg aaT AAT AAC TAG AGA GCT CAA GCT TTC TTT GA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or Omphalotin A (OphA) genes with C-terminal His-tags were cloned into the UTR1-T7RNAP-T500 plasmid backbone (Catalog No. 67739, Addgene). The T7 Max promoter was further cloned into these plasmids for downstream experiments ...
-
bioRxiv - Developmental Biology 2022Quote: ... or synthesized (NLS and N1ICD the fragment of [ENSMUST00000028288.5] encoding the C-terminal 789 AA of the Notch1 protein) and cloned with sequence encoding an N- or C-terminal eGFP into a modified version of pLKO.3G (Addgene, Cat #14748 ...
-
bioRxiv - Microbiology 2022Quote: ... C-terminal FLAG-tagged TMPRSS2 orthologues and the human ΔHDS mutant were ligated into the lentiviral pWPI-BLR vector (Addgene) via restriction digestion or using HiFi Builder (NEB) ...
-
bioRxiv - Pathology 2024Quote: ... (WT and variants) with a mTurquoise (mTq2) tag on the C-terminus were cloned into a pSBtet-pur vector (Addgene) using SfiI sites ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequences encoding N-KSR or C-KSR were subcloned into SfiI sites of pSBbi-pur-H-2Kb (# 111623, Addgene, USA) replacing an existing H-2kb fragment ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA for expressing CRY2olig tagged with mCherry at its C-terminus was obtained from Addgene (#60032; Watertown, MA, USA). The plasmid (1.0 µg/dish ...
-
bioRxiv - Biochemistry 2023Quote: Restriction-free cloning 30 was used to generate the constructs of MglA-link-MglB with C-terminal hexahistidine tag in pHis17-KanR (mglA-link-mglB-H6, refer Addgene plasmid #78201 for vector backbone ...
-
bioRxiv - Bioengineering 2023Quote: The pSECRETS-C plasmids containing desired on-target sequences were constructed via HiFi assembly into the p11.LacY.wtx1 plasmid (Addgene #69056), which was double digested with XbaI and SphI ...
-
bioRxiv - Cell Biology 2023Quote: The human sFLT1-HA plasmid construct created through Gibson cloning of human sFLT1 cDNA into a pcDNA3.1 vector containing a C-terminal HA tag (pcDNA3-ALK2-HA, Addgene 80870). Sequencing validation was performed through Genewiz ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... A sgRNA targeting the SYNGAP1 c.1507C site was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). The sgRNA together with the HDR template to introduce the 1507C>T mutation ...
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNAs encoding either APC/C resistant (APC/CR) mVenus-cyclin A2 or mVenus-cyclin B1 were cloned into pINDUCER20 (plasmid #44012; Addgene) by replacing the gateway cassette sequence and were synthesized by Twist Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... The pCAG-V5-TurboID vector was constructed by inserting the amplified TurboID cDNA containing the V5 epitope (GKPIPNPLLGLDST) sequence at the N-and C-terminal sites into the pCAGGS expression plasmid (Addgene). Expression plasmids encoding V5-TurboID-Solo and Solo-TurboID-V5 were constructed by inserting amplified Solo cDNA with a GS-linker (GGGSx2 ...
-
bioRxiv - Biophysics 2023Quote: ... human SLC26A9 (WT and missense mutants) with a C-terminally attached mTurquoise (mTq2) tag were cloned into a pSBtet-pur vector (Addgene) using SfiI sites ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by digestion of amplified PCR product with AgeI and NotI and ligation C-terminal to Smo in Smo-mCherry (Addgene plasmid 55134 ...
-
bioRxiv - Cell Biology 2024Quote: ... The sequences were subsequently cloned in the destination vector MAC-tag-C, a gift from Markku Varjosalo (Liu et al., 2018) (Addgene plasmid # 108077 ...
-
bioRxiv - Molecular Biology 2024Quote: The human codon optimized SsdAtox domain was synthetized (Integrated DNA Technologies) and cloned into either the N-terminus or C-terminus of a modified pCMV_BE4max vector (Addgene #112093) with the UGI domain deleted ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or N- and C-terminal parts were amplified in separate PCR reactions using constructs by Rihtar et al (45) obtained from Addgene (vectors were kind gifts from Roman Jerala ...
-
bioRxiv - Developmental Biology 2024Quote: ... with a C-terminal TwinStrep-tag (IBA LifeScience) joined by a 3xGlyGlyGlySer linker was also inserted into the pHLsec vector (Addgene_99845) between AgeI and KpnI restriction sites ...
-
bioRxiv - Developmental Biology 2024Quote: ... with a C-terminal TwinStrep-tag (IBA LifeScience) joined by a 3xGlyGlyGlySer linker was inserted into the pHLsec vector (Addgene_99845) between AgeI and KpnI restriction sites ...
-
bioRxiv - Biochemistry 2024Quote: Cloning of FRET constructs –Both ErCry4a and ErRBP1 were cloned in both an N-terminally tagged version as well as a C-terminally tagged version using the plasmids pmTurquoise-C1 and pmTurquoise-N1 (both a gift from Dorus Gadella (Addgene plasmid # 60558 ...
-
bioRxiv - Cancer Biology 2024Quote: ... GST-SH2 SHC1 (#46486)13 and GST-SH2 (encompassing both the N- and C-terminus) SHP2 (#67575)14 were purchased from Addgene. Phospho-Y222 antibody was developed using peptide CDQRGQSI-pY222-STSFPQP ...
-
bioRxiv - Biophysics 2024Quote: ... co-As were cloned into a PurExpress backbone that either contains an N-terminal 3x FLAG tag and C-terminal SNAP tag (NVD103, to be deposited on Addgene) or only a C-terminal SNAP tag (NVD005 ...
-
bioRxiv - Genetics 2024Quote: ... The following adenine base editor expression plasmids were used for mutation A-to-G to T-to-C transitions: ABE7.10 SpCas9-WT (Addgene # 102919), ABE7.10 SpCas9-VRQR (Addgene #119811) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A C-terminal Strep tag on ORF24-NTD was added by inverse PCR to generate p6H-SUMO3-ORF24-NTD-Strep (Addgene #138467).
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length UL87 was PCR amplified from HCMV Towne BAC DNA with primers to introduced EcoRI and XhoI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag) using T4 DNA ligase (Addgene #138434). Full-length mu24 was PCR amplified from MHV68-infected 3T3 cell cDNA with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag ...
-
bioRxiv - Cell Biology 2020Quote: ... obtained from Dharmacon) into pUAST vectors containing a C-terminal Venus open reading frame (Wang et. al, 2012, Addgene plasmid 35204). Transgenes were sequenced and then injected into embryos containing an attP8 site on the X chromosome (BDSC stock #32233 ...
-
bioRxiv - Cell Biology 2020Quote: ... containing human ATF6 cDNA fused to mCerulean on the C-terminal side of ATF6 was generated by amplifying ATF6 ORF from pEGFP-ATF6 (Addgene #32955) by PCR using the following primers ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Molecular Biology 2020Quote: ... We built plasmids by Gibson assembly for constitutive expression of histones and K27M mutant histones tagged at their C-termini with 2XFLAG epitope tags using the Copia promoter from the plasmid pCoPURO (Addgene 17533), and Drosophila H3 and H3.3 histones from previously published constructs (Ahmad & Henikoff ...
-
bioRxiv - Microbiology 2021Quote: VSV-G–pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene
-
bioRxiv - Biochemistry 2020Quote: ... Monobody HA4 or OptoMB variants were PCR amplified and Gibson-assembled from bacterial plasmids (described above) into a pHR vector with a C-terminal irFP fusion (Addgene #111510). The SH2 domain was amplified from EZ-L664 using PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... codon optimized coding sequences with a C-terminal HA epitope tag were synthesized by IDT and cloned into a pCW57.1 (Addgene plasmid #41393) derived lentiviral vector with a blasticidin resistance gene (replacing the original puromycin resistance gene) ...
-
bioRxiv - Microbiology 2020Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the FRET-aggregation reporters were generated by subcloning full length human α-synuclein PCR-amplified from pCAGGS-aSyn-CFP (a gift from Robert Edwards and Ken Nakamura)39 to the C-terminal Clover2 or mRuby2 into the lentiviral expression vector pMK1200 (Addgene #84219)21 under the control of the constitutive EF1A promoter ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA encoding peptides derived from the C-terminal last 10 residues of the norovirus and cellular proteins were cloned into the pET-His-GST vector (Addgene:29655) with an N-terminal GST tag ...
-
bioRxiv - Cell Biology 2022Quote: ... The mammalian expression plasmid for Ism1 with C-terminal myc-6xhis tag plasmid for recombinant Ism1 protein production was from Addgene (#173046).
-
bioRxiv - Cancer Biology 2022Quote: ... Constitutively active mouse STAT3 (STAT3-CA) plasmid Stat3-C Flag pRc/CMV was a gift from Jim Darnell (Addgene plasmid 8722).
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length BcRF1 was PCR amplified from pcDNA4/TO-BcRF1-3xFLAG (19) and cloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (C-terminal tag) using InFusion cloning (Addgene #138436). Mutations of the RLLLG motif in UL87 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length mu24 was PCR amplified from MHV68-infected 3T3 cell cDNA with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag) using T4 DNA ligase (Addgene #138435). Full-length BcRF1 was PCR amplified from pcDNA4/TO-BcRF1-3xFLAG (19 ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2021Quote: Fragments of Cnn-C-N and Cnn-T-N used in co-IP experiments were amplified from the pDONR-Cnn-C and pDONR-Cnn-T vectors described above by PCR and inserted into a pDEST-HisMBP (Addgene, #11085) vector by Gateway cloning (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2020Quote: hCIB2 was subcloned into pET21a (histidine tag on the C-terminus; hCIB2-6xHis) and GST-Rheb in pGEX-4T-2 (Addgene #15889), transformed in Bl2 (DE3 ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...