Labshake search
Citations for Addgene :
151 - 200 of 1659 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... with PCR of the hDlxI56i enhancer and minimal beta globin promoter from hDlxI56i-minBglobin-iCre-4X2C (Addgene #164450). hDlxI56i eGFP plasmid was made by cutting CMV-eGFP-synapsin (Chi et al. ...
-
bioRxiv - Genetics 2021Quote: sgRNAs were purchased as single-stranded DNA oligos (25nmoles standard desalted, IDT) with BbsI sticky ends and cloned in pairs into the pDG459 plasmid (Addgene #10090) for the deletion step using a one-step cloning reaction as described by the Thomas lab 25 The same protocol with the minor modification of replacing the second oligo with water during ligation was used to clone the syn-sgRNAs into pX459 (Addgene #62988) ...
-
bioRxiv - Systems Biology 2021Quote: All sgRNAs were synthesized as individual oligo pairs (IDT) and cloned into a barcode library containing plasmid pool (pBA571, Addgene #85968), thereby linking each sgRNA to a unique guide barcode contained within the 3′-UTR of the puromycin resistance gene (33) ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid for the expression of the tRNA/aminoacyl transferase pair (pNEU-hMbPylRS-4xU6M15, herein termed PylRS/4xtRNAPyl) was a gift from Irene Coin (Addgene, #105830)44 ...
-
bioRxiv - Molecular Biology 2022Quote: PegRNAs-expressing plasmids (pU6-pegRNA) were cloned by ligating annealed oligo pairs (Supplemental table 2) with BsaI-digested pU6-peg-GG-acceptor (Addgene #132777) as described previously (Anzalone et al. ...
-
bioRxiv - Immunology 2020Quote: ... and upstream of VH81-X (downstream of VH2-2) (Cut2) were cloned by annealing pairs of oligos into pX459 with a puromycin selection marker (Addgene, #62988) following the standard protocol ...
-
bioRxiv - Immunology 2021Quote: ... the Cas9 endonuclease and a single guide RNA (sgRNA) targeting the region in which the base pair change was expected to take place (Addgene 62988). The single stranded donor oligonucleotide (ssODN ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lenti-vectors expressing each pair of gRNAs targeting distal enhancers were packaged in 293T cells using pMD2.G (Addgene # 12259) and psPAX (Addgene # 12260) ...
-
bioRxiv - Genomics 2023Quote: We assembled the CRISPR/Cas9 vectors by annealing pairs of oligos carrying the sgRNA sequences and cloning them into pSpCas9(BB)-2A-Puro (PX459) (Addgene #62988) as described60 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the 3’ homology arm (1020 base pair downstream of the Cas9 cleavage site in the Shv gene region) was cloned into pHD-DsRed (Addgene, # 51434). Both cloned vectors were injected into fly stocks containing Cas9 (BDSC 55821 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Genomics 2021Quote: ... The plasmid pCI-neo beta catenin S33Y was a gift from Bert Vogelstein (Addgene plasmid # 16519; http://n2t.net/addgene:16519; RRID: Addgene_l6519).
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid, 49155; http://n2t.net/addgene:49155; RRID:Addgene 49155)) with primers ATGGTGAGCAAGGGCGAGGA and TTACCCTGTCTTATTGCTAAATGGAACGTAAAAGTTAGGACCCGAACGAGTGTAC TTGCCCCAAATGTG ...
-
bioRxiv - Genetics 2023Quote: ... a pDestTol2CG2-eye-bfp with the independent marker beta-crystaline:BFP a kdrl P-5’entry clone (Addgene, Santoro Lab), an EGFP-CAAX p-middle entry (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the ultramers as primers and AAT-PB-CD2APtk (Addgene #86004) or AAT-PB-PG2APtk111 (Addgene #195124 ...
-
bioRxiv - Neuroscience 2020Quote: ... was constructed with two heterospecific pairs of FRT and FRT5 sequences based on pAAV-EF1α-fDIO-hChR2(H134R)-eYFP (a gift from Karl Deisseroth; Addgene plasmid #55639). We used EF1α promoter to drive the expression of target constructs for all AAV vectors except for AAV-DIO-mRuby2-T2A-Synaptophysin-eGFP ...
-
bioRxiv - Neuroscience 2021Quote: The sgRNA expression vector was generated by cloning an annealed oligonucleotide pair (GTCGCCCTCAGTGGCTGACGCGCC and AAACGGCGCGTCAGCCACTGAGGG) into BbsI-digested pCFD3-dU6-3gRNA (Addgene no. 49410), as described (22) ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Microbiology 2020Quote: ... pmTurquiose2-Golgi (Beta-1,4-galactosyltransferase 1 1-61 Aa) in red is to show the Golgi apparatus (Addgene cat 36205) (27) ...
-
bioRxiv - Neuroscience 2022Quote: ... and simultaneously injected 150nL of a retrograde AAV expressing a td Tomato tag under the CAG (chicken beta-actin) promoter (rgAAV-CAG-td tomato; Addgene) (Tervo et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... a pair of complementary 20 bp oligos for each guide RNA sequence was annealed and cloned into pX330 (Addgene 42230; for guide 1) or pSG (a shuttle vector ...
-
bioRxiv - Genetics 2020Quote: ... from pBPZpGAL4DBDUw or a p65AD-Zip-containing PCR fragment amplified with oligo pair 3857/3858 from pBPp65ADZpUw (both plasmids (Addgene 26233 and 26234) were gifts from Gerald Rubin (Pfeiffer et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... with the only exception of ΔR2 and ΔF_ALL_Inv that were generated by using a pair of sgRNA. The guide sequences (listed in Supp. Table 1) were then cloned in px459 CRISPR/Cas9 vector (Addgene Cat. N. 62988), previously digested with Bbs1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The synthetic sgRNA oligo pair complementary to exon 1 was designed and cloned into lentiCRISPRv2 vector (Addgene #52961, gift from Dr. Feng Zhang)143 following the published protocol.49 For virus production ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral vector carrying human HNF4A was made by inserting human HNF4A825 (obtained from Addgene; cat# 31094) into the PGK-IRES-EGFP vector as described previously.26 Lentivirus was generated at the CCHMC viral vector core ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Molecular Biology 2022Quote: ... as template and the following primers was cloned into pX458 (Addgene # 48138) at the AgeI FseI sites.
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... SNAP- tagged human KOR (Addgene #66462), SNAP-tagged human DOR (Addgene #66461 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... SNAP-tagged human DOR (Addgene #66461) and SNAP-tagged mouse MOR (cloned from SSF-MOR ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Genetics 2022Quote: ... 2015) flanked by 2X core sequence of the HS4 chicken beta globin insulator was cloned into a targeting vector (Addgene #92142) that contains homology arms of the mouse TIGRE genomic locus (Madisen et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... sapiens beta-2-adrenergic receptor used as a control in BRET2 experiments was a gift from Robert Lefkowitz (Addgene plasmid #14697). Mm Arr-2 (NP_796205.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... Viral titers were determined using a qPCR method provided by Addgene. The typical viral titers were ∼ 1014 genome copies per mL.