Labshake search
Citations for Addgene :
101 - 150 of 1659 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... MSCV-beta-catenin-IRES-GFP was a gift from Tannishtha Reya (Addgene plasmid #14717). MSCV-Cre-IRES-GFP was previously described [9] ...
-
bioRxiv - Microbiology 2024Quote: ... 20ng encoding firefly luciferase driven by an IFN-beta promoter (IFN-Beta_pGL3, Addgene 102597), 5ng of renilla luciferase (pRL-TK - Promega E2241) ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... a human VEGFC target oligonucleotide (5′-GAGTCATGAGTTCATCTACAC-3′) was cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene plasmid # 42230). Two VEGFCKO clones were obtained by PEI transfection (Tebu Bio ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with each TGF-β1 shRNA construct along with packaging vectors pMD2.G (0.5 μg) and psPAX2 (1.5 μg) (Addgene, Inc., Watertown, MA) using Jet Prime Reagent (Polyplus-transfection® ...
-
bioRxiv - Immunology 2021Quote: ... Each pair of guides was cloned into the Cas9-2A-mRuby2 vector (https://www.addgene.org/110164/ Addgene #110164) following the protocol of the Feng Zhang laboratory (https://media.addgene.org/cms/filer_public/e6/5a/e65a9ef8-c8ac-4f88-98da-3b7d7960394c/zhang-lab-general-cloning-protocol.pdf) ...
-
bioRxiv - Genomics 2021Quote: ... Pairs of oligonucleotides (Eurofins) were annealed and subcloned into either sgRNA(MS2) cloning backbone (Addgene Plasmid #61424) or Lenti sgRNA(MS2)_zeo backbone (Konermann et al. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... oligonucleotide pairs (Table S8) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene no. 49410), as previously described [68].
-
bioRxiv - Biochemistry 2023Quote: ... the mito-gTEMP ratiometric reporter pair (see Fig. 3A) was recloned from mito-gTEMP_pcDNA3 (Addgene, plasmid #109117) into the pTriEx™-1.1 Hygro plasmid (Novagen 70928) ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Sup. Table 6) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410), as previously described84 ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Microbiology 2024Quote: ... sequence targeting the third exon of the human L1CAM gene (5’-GAGTAGCCGATAGTGACCTG-3’) was designed and cloned into the pKLV2-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene plasmid #67974). For the production of lentiviral particles carrying the CRISPR/Cas9 components ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Cell Biology 2020Quote: ... the GFP11x7 cassette was PCR amplified from pACUH:GFP11×7-mCherry-beta-tubulin (Addgene, plasmid # 70218), and integrated at the 5’ end of the SHE1 open reading frame using the sequential URA3 selection/5-FOA counterselection method ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... and were generated by ligation of annealed oligo pairs into the pU6::sgRNA expression vector pMB70 (Addgene #47942) as previously described (Waaijers et al. ...
-
bioRxiv - Genetics 2024Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722, originally from 29). Library1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Reduced Expression GFP beta actin was a gift from Rick Horwitz & Tim Mitchison (Addgene plasmid # 31502). In this plasmid the base pairs 91-544 of the enhancer region in the CMV promoter are deleted ...
-
bioRxiv - Microbiology 2020Quote: ... GSK3β-S9A (HA GSK3 beta S9A pcDNA3 was a gift from Jim Woodgett, Addgene plasmid # 14754). Plasmids were purified from a host E ...
-
bioRxiv - Microbiology 2020Quote: ... GSK3β-WT (HA GSK3 beta wt pcDNA3 was a gift from Jim Woodgett, Addgene plasmid # 14753), GSK3β-S9A (HA GSK3 beta S9A pcDNA3 was a gift from Jim Woodgett ...
-
bioRxiv - Cell Biology 2020Quote: ... human KLF4 (RRID:Addgene_17219), human c-MYC (RRID:Addgene_17220 ...
-
bioRxiv - Cell Biology 2020Quote: ... human SOX2 (RRID:Addgene_17218), human KLF4 (RRID:Addgene_17219) ...
-
bioRxiv - Neuroscience 2022Quote: ... human DNAJB4 (Addgene) and DNAJB6 (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... The internal ribosome entry site (IRES) was amplified with fwd primer 1998 and reverse primer 1903 from pMSCV-IRES-mCherry-FP (Addgene #52114). GFP-NLSx3 was amplified from our previously described GFP-NLSx3 pBabe puro vector [67] using fwd primer 1833 and rev primer 1834 ...
-
bioRxiv - Cell Biology 2024Quote: ... human Dynamin2 (#27689) and human AP2μ2 (#27672) were purchased from Addgene. cDNA encoding human AP2β2 (Clone ID ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 3 target sequences in the human TFE3 gene (GGCGATTCAACATTAACGACAGG, GCGACGCTCAACTTTGGAGAGGG, TCGCCTGCGACGCTCAACTTTGG) and cloned these into the lentiCRISPR v2 vector (Addgene #52961, Watertown, MA, USA). Lentivirus was produced as previously described 1 and HK-2/SFPQ-TFE3 cells were infected for 48 h ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Cell Biology 2022Quote: ... pairs of oligonucleotides with BsmBI-compatible overhangs were separately annealed and cloned into the lentiGuide-Puro vector (Addgene #52963) using standard protocols available via https://www.addgene.org/52963/ ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA plasmids were generated by ligation of annealed oligo pairs into the pU6::sgRNA expression vectors pMB70 (Addgene #47942) or pJJR50 (Addgene #75026 ...
-
bioRxiv - Physiology 2023Quote: ... FLAG-Mma PyIRS (Mma PylT/RS) and pAS_4xhybPylT A41AA C55A FLAG-G1 PylRS Y125A (G1PylT/RS) tRNA/aminoacyl-tRNA synthetase pairs from Addgene (Watertown ...
-
bioRxiv - Neuroscience 2021Quote: ... Primers were used on the pCFD6 template (Addgene #73915) using high-fidelity Phusion polymerase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... The PCR primers and conditions are available from Addgene. The PCR product were mixed and cleaned using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... Primers were cloned into LentiGuide-Puro (Addgene plasmid #52963) by phosphorylating ...
-
bioRxiv - Immunology 2023Quote: ... and ligating primers into LentiGuide-Puro (Addgene, plasmid 52963). Colonies were validated by Sanger sequencing using pLK0.1/hU6 promoter primer (Eton Biosciences ...
-
bioRxiv - Microbiology 2022Quote: ... pCMV encoding HIV-1 Vpr fused to beta lactamase (pCMV4-BlaM-Vpr) was obtained from Addgene (21950). A plasmid encoding replication-incompetent HIV-1 lacking env and vpr and encoding luciferase (pNL4-3LucR-E- ...
-
bioRxiv - Neuroscience 2024Quote: ... to final titers (determined by Addgene by qPCR) of 8.5 × 10^10 gc/ml and 1.6 × 10^12 gc/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Biochemistry 2024Quote: Human Drosha isoform 4 and human DGCR8 clones were purchased from Addgene. cDNA encoding different length variants of Drosha were cloned into pFL plasmid and expressed as a N-terminal Dual-strep tag fusion ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... human RIPK3 (Addgene #78804), mouse RIPK1 (Addgene #115341) ...
-
bioRxiv - Cancer Biology 2024Quote: ... pMJ117 (human U6; RRID:Addgene_85997), using site-directed mutagenesis (Supplementary Figure S1h) ...
-
bioRxiv - Cell Biology 2021Quote: ... Each guide RNA pair was cloned into either the ‘All-in-one-mCherry’ plasmid (AIO-mCherry, gift from Steve Jackson (Addgene plasmid # 74120 ...
-
bioRxiv - Neuroscience 2024Quote: ... were cloned by ligating annealed oligonucleotide pairs (Supplemental table 5) into the BsmBI-digested pBPK1520 plasmid (BPK1520 was a gift from Keith Joung. Addgene#65777 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1128 base pairs of HyNotch-NICD (1648-2775 of Notch mRNA) was inserted into the vector pHyVec11 (Addgene plasmid #34794) and was driven by the Hydra actin promoter ...
-
bioRxiv - Immunology 2024Quote: ... and pGEX-4T2-14-3-3 tau (θ) (Addgene #13281) were gifts from Michael Yaffe (Yaffe et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613; http://n2t.net/addgene:60613; RRID:Addgene_60613 ...