Labshake search
Citations for Addgene :
451 - 500 of 1659 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: [3] 5XQUAS from pQUAST-mCD8-GFP (Addgene plasmid #24351) (Primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 promoter fragment sequence amplified from Addgene plasmid #49411 23 with primers 1045.C1 and 1045.C2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) AAV1.hSyn.GCamP6s.WPRE.SV40 (6.67×1012 GC/kg, Addgene #100843). Before puncturing a capillary of interest ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene) in a 10 cm dish ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(I224A/L227A/W276A/I279A)-GFP (ΔLIR1+3) (RRID:Addgene_223780), BCL2L13(W276A/I279A/I307A/V310A)-GFP (ΔLIR1+4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μg pCMV-VSV-G plasmid (Addgene, 8454) was used for each transfection ...
-
bioRxiv - Biophysics 2020Quote: We amplified OsTIR1 from pMK232 100 via PCR with the primers Cloning_OsTIR1_fw and Cloning_OsTIR1_rev and inserted it into the pLenti backbone from pLenti-CMV-rtTA3 (Addgene plasmid #26429) by digestion with BstXI ...
-
bioRxiv - Neuroscience 2020Quote: Primers containing linkers attached to each target without the PAM sequence were used for PCR with pCFD4 (RRID:Addgene_49411) as a template ...
-
bioRxiv - Cell Biology 2020Quote: ... using the primers GCTAGAATTGACCGGATGAGGAGAAGTGAGGTGCTG (FWD) and CATGGTGGCGACCGGTAAATTCGAAGCTTGAGCTCGAGATCTGAGGGACTGGATGTTGGTTGAATTGAGG (REV) and inserted into plasmid tgRFPt-SspB WT (Addgene number: 60415) (Guntas et al. ...
-
bioRxiv - Genetics 2020Quote: The primers ABEmax-F/ABEmax-R and AncBE4max-F/ AncBE4max-R was used to amplified pCMV_ABEmax_P2A_GFP (Addgene #112101) and pCMV_AncBE4max (Addgene #112094 ...
-
bioRxiv - Genomics 2020Quote: ... we amplified Ultramers with primers containing sequence homologous to either the STARR-seq luciferase validation vector_mP_empty (Addgene# 99298) or pGL4.23 (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... using primer 1008F and 1007R and cloning it into AgeI and FseI sites of pLdCH (Addgene #84291, (7)) ...
-
bioRxiv - Cell Biology 2023Quote: ... were created via PCR amplification (see primer list) and assembled into a Spe-1 digested pCFJ151 (Addgene #19330) vector using isothermal assembly (Gibson et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... using pLenti_mENPP1_fwd and pLenti_mENPP1_rev primers in Table S1 and inserted into the XbaI-BamHI sites of pLenti-CMV-GFP-Puro (Addgene). To clone pLenti-CMV-mENPP1-T238A-GFP-Puro plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... The TIS11B coding sequence was amplified from pcDNA3.1-puro-GFP-TIS11B using TIS11B MCP F and TIS11B MCP R primers and the TIAL1 coding sequence was PCR amplified from pFRT_TO_FlagHA_TIAL1 (Addgene 106090) using TIAL1 MCP F and TIAL1 MCP R primers.
-
bioRxiv - Immunology 2023Quote: ... The wzm – wbbO PCR product was assembled with PCR-linearized pBBR1MCS2 plasmid (Addgene, primers pBBR1-1F/pBBR1-1R) using an NEBuilder HiFi DNA Assembly kit (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... i7 primer binding underlined) was cloned by Gibson assembly into pLenti-Puro-AU-flip-3xBsmBI 73 (Addgene #196709). The plasmid library was sequenced to confirm representation and packaged into lentivirus in HEK293T cells using plasmids psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... The Toronto human knockout pooled library (TKO) Version 1 (Addgene #1000000069) was a gift from Jason Moffat19.
-
bioRxiv - Molecular Biology 2021Quote: ... The human TLR4 overexpression plasmid was purchased from Addgene (Cat. #13086). The T695A and T656A mutations were generated in WT-YME1L1 plasmid via QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... human ubiquitin C-driven CymR Cuo repressor purchased from Addgene (#119907) into pPig-Hygro transposase backbone from Max Wilson ...
-
bioRxiv - Cell Biology 2022Quote: ... tdmIRFP from Max Wilson and human GSK3β purchased from Addgene (# 16260) ORFs were supplied to VectorBuilder for cloning and EF1α-driven expression into 3rd generation lentiviral backbone ...
-
bioRxiv - Biochemistry 2021Quote: ... pLenti CMV/TO Zeocin DEST with either human XBP1s insert (Addgene), and pLenti CMV hygromycin DEST with a DHFR.ATF6(1-373 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmids encoding wild-type human RAB11 (#12679) was obtained from Addgene. The following primer sets were used for site directed mutagenesis:
-
bioRxiv - Cancer Biology 2020Quote: Human Tks5α was cloned into pCDH-CMV-MCS-EF1-Puro (Addgene) with a GFP sequence fused at the C-terminus ...
-
bioRxiv - Microbiology 2020Quote: Human CRISPR knockout pooled library (Brunello) was obtained from Addgene (#73178). Human CRISPRi pooled library (Dolcetto ...
-
bioRxiv - Cell Biology 2021Quote: ... The following plasmids were used: pEGFP-N1 human cofilin (Addgene 50859) and td-Tomato-LifeAct 7 (Addgene 54528).
-
bioRxiv - Cell Biology 2020Quote: Human WT CXCR4 was acquired as a donor plasmid (#81957, Addgene) and recombined into a lentiviral destination vector (#25890 ...
-
bioRxiv - Cell Biology 2021Quote: The human GeCKO v2 library (2 plasmid system) (Addgene plasmid #1000000049) was amplified by electroporation using a Bio-Rad Gene Pulser II electroporation apparatus (Bio-Rad #165-2105 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454 ...
-
bioRxiv - Genomics 2022Quote: Human STARR-seq-ORI vector was obtained from Addgene (plasmid #99296). 8ug of STARR-seq plasmid was digested with 20uL AgeI-HF® (R3552 ...
-
bioRxiv - Biochemistry 2022Quote: ... The recombinant human PRKACA cDNA was obtained from Addgene (Plasmid #23495) and cloned into between BamHI and KpnI in pcDNA5 vector (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: The human CRISPR knockout pooled library Brunello was obtained from Addgene (a gift from David Root and John Doench ...
-
bioRxiv - Cell Biology 2020Quote: 100 ng of human sgRNA library Brunello in lentiCRISPRv2 (Addgene, #73179) was transformed into electrocompetent Endura cells (#60242 ...
-
bioRxiv - Neuroscience 2020Quote: Human pcDNA3.1-CHRNA7-mGFP was a gift from Henry Lester (Addgene plasmid # 62629 ...
-
bioRxiv - Microbiology 2021Quote: ... The lentiviral vector expressing human ACE2 (Dr. Sonja Best, Addgene 154981) was used with the lentiviral packaging plasmid psPAX2 (Dr ...
-
bioRxiv - Immunology 2020Quote: GeCKO and Brunello whole-genome human libraries were acquired from Addgene. Smaller scale validation library was created by selecting the top 300 positive and 50 negative regulators from the Brunello screen and filtering for expression in Ramos cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... and/or the mammalian expression vectors for human HNF4A2 (#31100, Addgene), LXRα (110) ...
-
bioRxiv - Neuroscience 2023Quote: Human Htt-exon1-Q94 fragment from pTreTight-Htt94Q-CFP (Addgene, #23966) was cloned into pBlueScript SK+ (kind gift of Eva Brinkman ...
-
bioRxiv - Biochemistry 2022Quote: Monomeric EGFP was subcloned into vectors containing human AR (Addgene #29235) and AR-V7 (Addgene #86856 ...
-
bioRxiv - Microbiology 2023Quote: Human TREX1 sequences were derived from plasmid GFP-TREX1 (Addgene 27219) and TREX1-D18N (Addgene 27220).
-
bioRxiv - Biophysics 2023Quote: Histidine-tagged human RAD52 FL (RAD52 FL) expression vector (pET15b; Addgene) was transformed in E ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNA encoding human cGAS (NM_138441.3) was purchased from Addgene (#108674) and subcloned into pEGFP-C3 vector.
-
bioRxiv - Cell Biology 2023Quote: Plasmid containing CDS sequences of human MCU were taken from Addgene and restriction digestion was performed ...
-
bioRxiv - Immunology 2023Quote: Human CD86 C-terminally tagged with enhanced GFP (pCD86-EGFP, Addgene) was sub-cloned into a modified version of the MSCV2.2 retroviral plasmid in which the IRES-GFP cassette was removed ...
-
bioRxiv - Cancer Biology 2023Quote: Human GBM cells were transduced with the 7TGC (Addgene plasmid #24304), 7TGC-SFRP1 or 7TGC-Notum lentiviral vectors at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2023Quote: ... and Human Interferon-Stimulated Gene CRISPR Knockout pooled Library (#125753, Addgene) (OhAinle et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The human RTCB gene was inserted into the 438B (Addgene: 30115) plasmid and the 438-Rgfp (Addgene ...