Labshake search
Citations for Addgene :
1 - 50 of 1659 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... or the human IFN-beta promoter (IFN-Beta-pGL3, Addgene #102597), renilla luciferase fused to herpes simplex virus thymidine kinase promoter (pTK-Renilla ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Neuroscience 2020Quote: ... amplified with a pair of primers: CCGCGAAGATCTATGAGTAAAGGAGAAGAACTTTTCAC and GGCAGTCGACCTGCAGCCGCGGCCGTTTGTATAGTTCATCCATGCCATG into pDisplay-mSA-EGFP-TM (Addgene plasmid #39863) (Lim et al. ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1 ...
-
bioRxiv - Immunology 2021Quote: ... TPC2(L564P):GCaMP6s and TPC2(L265P/L564P):CaMP6s sequences were amplified (forward primer, 5’-TCCGAATTCAATGGGTTCTCATCATCATCATCATCA-3’, reverse primer, 5’-GATACCGGTTGCAACTTCGCTGTCATCATTTGTACAAAC-3’) and subcloned into mApple N1-vector (Addgene #54567) via EcoRI und AgeI sites.
-
bioRxiv - Cell Biology 2024Quote: ... a FLAG-RPB1-N792D-ΔCTD fragment was PCR amplified (Forward primer: 5’ – CAATTCCACAACACTTTTGTCTTATACTTGGATCCATGGACTACAAGGACGACGATGACA - 3’; Reverse primer: 5’ – TAGGGGGGGGGGAGGGAGAGGGGCCGGCCGGGGCTCAGCTGGGAGACATGGCACCAC – 3’) from FLAG-Pol2-WT (Addgene, 35175) (55 ...
-
bioRxiv - Bioengineering 2020Quote: ... VPR was amplified by primer pair VPR-F/R (template source: pWalium20-10XUAS-3XFLAG-dCas9-VPR (Addgene No.: # 78897)(Lin et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The NANOS3 gRNA expression cassettes driven by HU6 and ZU6 promoters were generated in the same manner using primer pair HU6(AgeI)_F and HU6_Nanos3gRNA(NheI)_R with gRNA_GFP-T2 (Addgene # 41820) plasmid as template DNA and primer ZU6_F1 and ZU6_Nanos3gRNA(NheI)_R with pDestTol2pA2-U6:gRNA (Addgene # 63157 ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA of APLF full length and APLFΔFHA and APLFΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) (Horn et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... a pair of single guide RNAs (sgRNA) targeting human TROP2 were inserted into lentiCRISPRv2 (Addgene, # 98293) and corresponding oligonucleotides were inserted into the pARv-RFP reporter vector (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: The knockdown plasmids for REST/NRSF and for the control GFP were constructed by ligating annealed primer pairs into the pLKO.1 vector (Addgene) between the EcoRI and AgeI sites ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ITGB3 sequence (pcDNA3.1-beta-3 was a gift from Timothy Springer; Addgene plasmid # 27289) was subcloned into pLenti6.3/TO/V5-Blasti (A11144 ...
-
bioRxiv - Plant Biology 2022Quote: ... AA106 and AA107) and mNeonGreen (primer pair: AA108 and AA109) were amplified from Zea mays B73 cDNA and mNeonGreen-2A-mTurquoise2 (Addgene #98885), respectively ...
-
bioRxiv - Plant Biology 2023Quote: ... we amplified a 10xHis-MBP coding fragment by PCR with primers pair 10xHis-MBP-F and 10xHis-MBP-R from pMAL-c2X® vector (Addgene), and cloned it into pTrcHis® vector (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Sup. Table 3) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410)76 ...
-
bioRxiv - Genetics 2024Quote: ... Beta (Addgene # 170449), Gamma (Addgene # 170450) ...
-
bioRxiv - Neuroscience 2024Quote: ... an oligonucleotide pair (Supplemental Table 3) was annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410) as described (Port et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... and Δ50 were PCR amplified from human templates using forward (fwd) primer 1593 and reverse (rev) primer 1651 and inserted into mycBioID2 pBabe puro (Addgene #80901) cut EcoRI to PmeI ...
-
bioRxiv - Cell Biology 2022Quote: ... subcloning from the following constructs: XLone-Axin-tdmRuby3 (above) and Human Beta-catenin GFP purchased from Addgene (#71367). The following primers were used ...
-
bioRxiv - Biochemistry 2020Quote: ... DGK beta (Addgene; 35405) were from Robert Lefkowitz and Stephen Prescott ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10ug pX458 2.0 plasmid pairs (Addgene) encoding Cas9 and sgRNAs were transfected using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... IFN-Beta-pGL3 (Addgene 102597), or empty vector pcDNA3.1 (Life Technologies V79020 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Immunology 2020Quote: ... sgRNAs targeting the endogenous Rosa26 locus or 3’ end sequence of the Wapl gene were cloned by annealing pairs of oligos into pX330 (Addgene, #42230) to construct the pX330_Rosa26 and pX330_Wapl-mAID ...
-
bioRxiv - Genetics 2021Quote: ... Pairs of guide RNAs targeting upstream (5’) and downstream (3’) flanking sequences were designed and cloned into LentiCRISPRv2-GFP (Addgene #82416) and LentiCRISPRv2-mCherry (#99154 ...
-
bioRxiv - Neuroscience 2020Quote: ... via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Beta-Catenin-20 (Addgene plasmid 55001 ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Cell Biology 2024Quote: ... and a pair of TALENs (Addgene # 59025, # 59026) through co-electroporation into hPSCs ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: ... reverse primer: 5’-ATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC-3’) and cloned into pLentiCRISPRv2-Opti (a gift from David Sabatini; Addgene plasmid # 163126 ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used a TGF-β reporter plasmid pSBE4-Luc (Addgene, plasmid #16495). This plasmid contains four tandem copies of the Smad binding sites ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613 ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...