Labshake search
Citations for Addgene :
1801 - 1829 of 1829 citations for KGF 2 FGF 10 Human 171a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Sunday driver mediates multi-compartment Golgi outposts defects induced by amyloid precursor proteinbioRxiv - Neuroscience 2021Quote: ... and EGFP cDNA were amplified by PCR and transferred into the vector pJFRC2-10×UAS-IVS-mCD8-GFP (plasmid #: 26214, Addgene, Cambridge, MA). The construct was then injected into embryos of PBac{y[+]-attP-3B}VK00033 to generate transgenic flies ...
-
bioRxiv - Microbiology 2022Quote: Individual guide RNA (gRNA) sequences (Supplemental Table 1) were cloned into BsmBI-digested lentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang [10]) and resulting lentiviral stocks prepared as previously described [11] ...
-
bioRxiv - Cell Biology 2022Quote: ... K562 CRISPRi cells with or without MICU1(GFP1-10) were nucleofected with a MTCH2 targeting guide in the pX458 backbone (Addgene plasmid # 48138) using the Lonza SF Cell Line 96-well Nucleofector Kit (V4SC-2096) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 × 106 cells of each cell line were electroporated with a mixture of 10 μg of plasmid pEGFP-D50 lamin A (Addgene plasmid #17653) that had been linearized with EagI and 1 μg of pBABE-puro (Addgene plasmid #1764 ...
-
bioRxiv - Developmental Biology 2022Quote: ... HEK293T cells at 70-80% confluency in 10 cm dishes were transfected with the insert construct plus 3rd generation packaging plasmids: pMD2.G (3 μg, Addgene plasmid #12259), psPAX2 (6 μg ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were then injected bilaterally with 500 nl of AAV-CaMKIIa-ChR2-EYFP (Addgene, #50469, 2.3 x 10^13 particles per ml) in the secondary motor cortex (AP ...
-
bioRxiv - Developmental Biology 2024Quote: ... in the canal was generated by microinjection of plasmid pWD285 at 10 ng/µL concentration with coinjection markers pCFJ90 (Addgene Plasmid #19327) and pCFJ104 (Addgene Plasmid #19328 ...
-
bioRxiv - Biophysics 2023Quote: ... followed by ligation in place of the mApple sequence in the mApple-CD36-C-10 vector (Addgene, Watertown, MA plasmid # 54874 (5)) ...
-
bioRxiv - Cell Biology 2023Quote: ... The fragments of bPAC and TGNP were amplified from cytoplasmic-bPAC (a gift from Dr. Reiter lab) and pmApple-TGNP-N-10 (Addgene plasmid #54954), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids used for tdTomato-Tau overexpression and the tdTomato-C1 control plasmid were a gift from Michael Davidson: tdTomato-MAPTau-C-10 (Addgene plasmid #58112), tdTomato-MAPTau-N-10 (Addgene plasmid #58113 ...
-
bioRxiv - Immunology 2024Quote: ... 293T cells were transfected with 10 ug of lenti-CRISPR-V2-CRE construct along with packaging plasmid 6 ug of PsPAX2 (Addgene, Cat #12260) and 3.5 ug of PmD2.G (Addgene ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2019Quote: ... CDC45: guide#1 GCATCAGGGTCGGGCTCTGA and guide#2 GCTCTGTCCTCCCTCAACGG) were inserted into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene plasmid #42335, a gift from Feng Zhang) via BbsI restriction site ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Molecular Biology 2022Quote: ... Conditional knockout cells were generated by infection with media from a confluent 10 cm dish of 293T cells transfected with 3 µg pCL-Eco (Addgene, 12371 ref (17)) and 3 µg MSCV CreERT2 puro (Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... HEK 293T cells in 10-cm dishes were transfected at 80% confluence with the lentiviral plasmid pLenti-CMV-Puro (Addgene plasmid no. 17452) containing the gene of interest (2 mg ...
-
bioRxiv - Cell Biology 2019Quote: To generate clonal cell lines that are deficient for SURF4, a sgRNA targeting SURF4 exon 2 (SI Appendix, Table S1) was cloned into the PX459 plasmid (Addgene: 62988, a gift from Feng Zhang) as previously described (95) ...
-
bioRxiv - Microbiology 2024Quote: ... pcDNA-V5-NSP3 was generated by amplifying the full-length NSP3 ORF from pDONR207 SARS-CoV-2 NSP3 (Addgene #141257; a gift from Fritz Roth (86)) and by subcloning it into the pcDNA3-C-V5 vector ...
-
bioRxiv - Neuroscience 2021Quote: ... were performed over a 5 min period with 1 µL of AAV9-hSyn-Cre (Titer ≥ 1×10¹³ vg/mL, Addgene, Cat. No. 105553-AAV9) or un-injected ...
-
bioRxiv - Genetics 2022Quote: ... the NotI/XbaI PCR fragment of eggpl-CDS (GFP tag) was cloned into the NotI/XbaI sites of pJFRC28-10 × UAS-IVS-GFP-p10 vector (Addgene Plasmid, cat. no. 36431). The primer pairs used for PCR validation were as following:
-
bioRxiv - Neuroscience 2023Quote: ... A microsyringe (Nanoject) was used to inject 0.75 µL of AAV5-Syn-GCaMP6f-WPRE-SV40 (Addgene, injected titer of 1.3×10^13 parts/ml) unilaterally into the mPFC (1.6 mm anterior ...
-
bioRxiv - Immunology 2022Quote: ... target cells were derived by transfection with plasmids designed to express the SARS-CoV-2 D614 Spike protein with a c-terminus flag tag (kindly provided by Dr. Farzan, Addgene plasmid no. 156420 (Zhang et al., 2020)) ...
-
bioRxiv - Microbiology 2021Quote: ... The coding sequence from amino acid 747E to 1061K was amplified by PCR from the pDONR207 SARS-CoV-2 NSP3 plasmid (Addgene, #141257, a gift from Fritz Roth[32]), including a Kozak sequence and ATG start codon in the forward primer and a TAA stop codon in the reverse primer (PLPcd_Fw ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by ligation in place of the mApple sequence in the mApple-CD36-C-10 vector (plasmid # 54874, Addgene, Watertown, MA (Githaka et al., 2016)) ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were cultured in 10-cm dishes and transiently transfected with 9 μg lentiviral plasmid pLV-ER-GFP (Cat# 80069, Addgene, a gift from Pantelis Tsoulfas), 8 μg pCMV-dR8.91 ...
-
bioRxiv - Neuroscience 2024Quote: ... We used Th-cre mice and injected 375nl AAV2/9-CAG-Flex-ChR2-tdTomato into the VTA and infused 450nl AAV9.CamKII.GCaMP6s.WPRE.SV40 (Addgene 107790-AAV9, 2.5 x 10^13 GC/mL) into M2 (Bregma ...
-
bioRxiv - Neuroscience 2021Quote: ... Black-6 mice were first injected with 120nL of a retrograde virus encoding Cre (AAVrg-Ef1a-mCherry-IRES-Cre, titer of 1.37 x 10^13, Addgene viral prep # 55632-AAVrg, provided to Addgene by Karl Deisseroth (Fenno et al., 2014)) in either the central lateral nucleus (CL ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f: Addgene 104488; dilution 1:10 ∼ 1x1013 GC/mL) and AAV1.Syn.Flex.Chrimson.tdTomato (UNC Vector Core ...
-
bioRxiv - Microbiology 2024Quote: ... HEK293T cells were cultured in 10-cm dishes and transiently transfected with 9 µg lentiviral plasmid pLV-ER-GFP (Addgene, 80069, a gift from Pantelis Tsoulfas), 8 µg pCMV-dR8.91 ...