Labshake search
Citations for Addgene :
1651 - 1700 of 1708 citations for KGF 2 FGF 10 Human 171a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... were maintained in DMEM supplemented with 10% FBS and 1x penicillin/streptomycin were used to produce lentiviral particles with psPAX2 (Addgene 12260), pMD2.G (Addgene 12259 ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 10% FBS and 1% penicillin-streptomycin, and equal amounts of plasmids (250 ng of each: luciferase reporter, actin-GAL4 (Addgene #24344), one dCas9-Rb constructs ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of diluted CaMKII.GCaMP6f (AAV1, diluted 1:3 with dPBS or AAV9, diluted 1:10 with dPBS, Addgene number: 100834) was injected in three locations throughout auditory cortex (1.5 mm from lambda ...
-
bioRxiv - Cell Biology 2024Quote: ... and ligated into the pre-digested promoter-less plasmid to generate the pAAVS1-P-CAG-mNG21-10 repair template (Addgene #206042). For BclI digestion ...
-
bioRxiv - Cell Biology 2022Quote: ... with AgeI and BstBI restriction sites into the pLenti CMV/TO GFP-MDC1 (779-2) (plasmid #26285, Addgene, gift from E. Campeau; Genewiz) backbone ...
-
bioRxiv - Genomics 2019Quote: ... We co-transfected the pLentiRNACRISPR constructs together with a GFP expression plasmid in a 2:1 molar ratio. The guide RNA length comparison (Supplementary Fig. 1d) was done using previously published RfxCas13d constructs (Addgene 109049 and 109053), except that we removed the GFP cassette from the RfxCas13d plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Cancer Biology 2020Quote: pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines were obtained upon transfection of the SAOS 2 cell line with the plasmids pBABE-puro or pBABE-puro-hTERT from Addgene (#1764, #1771, respectively), and Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids encoding the SARS-CoV-2 open reading frames proteins and eGFP control were a kind gift of Nevan Krogan (Addgene plasmid #141367-141395). Plasmids were acquired as bacterial LB–agar stabs ...
-
bioRxiv - Neuroscience 2022Quote: ... All cell lines presented in this study are available from the corresponding author upon request and all plasmids are available from Addgene (Supplementary Table 2).
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660) and the lentiviral expression construct ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned from pLVX- EF1alpha-SARS-CoV-2-M-2xStrep-IRES-Puro and pLVX-EF1alpha-SARS-CoV-2-E-2xStrep- IRES-Puro (kind gifts from Nevan Krogan, available from Addgene #141386 and #141385) using PCR to remove the 2xStrep epitope tag ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK293T cells were transfected with psPAX2 and pMDG.2 packaging plasmids (gifts from Didier Trono, EPFL, Lausanne, Switzerland; Addgene plasmids 12559 and 12660), the lentiviral expression plasmid ...
-
bioRxiv - Biophysics 2022Quote: The plasmid encoding GPCR kinase subtype 2 used for the receptor phosphorylation in insect cells (GRK2-CAAX) was a gift from Robert Lefkowitz (Addgene plasmid #166224 49). Full-length arrestin21-418 (C150L ...
-
bioRxiv - Cancer Biology 2022Quote: ... shNFATC2IP#2: ACATTTGCTTGAGGCTTATAC) were cloned into Tet-pLKO-puro or TET-pLKO-neo vectors (gifts from Dmitri Wiederschain, Addgene plasmids #21915 and #21916). Hairpins were introduced by lentiviral transduction using pRSV-Rev (Addgene plasmid # 12253) ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were grown in 10-cm dishes to 80% confluency before transfection with the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Developmental Biology 2021Quote: We grew HEK293T cells in 10-cm dishes to a confluence of 80% before we transfected the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... a whole- genome library of exon-targeting sgRNAs (10 sgRNA per gene; Morgens et al., 2017) was synthesized and cloned into a lentivirus vector (Addgene, Cat# 89359) which together with third- generation lentiviral packaging plasmids (pVSVG ...
-
bioRxiv - Neuroscience 2022Quote: ... into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL, #114469-AAVrg, Addgene, MA, USA) into the HP ...
-
bioRxiv - Neuroscience 2022Quote: ... P0-1 pups received the viral construct AAV9-hSyn-hChR2(H134R)-EYFP (200 µl at titer ≥ 1×10¹³ vg/mL, #26973-AAV9, Addgene, MA, USA) into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
Sunday driver mediates multi-compartment Golgi outposts defects induced by amyloid precursor proteinbioRxiv - Neuroscience 2021Quote: ... and EGFP cDNA were amplified by PCR and transferred into the vector pJFRC2-10×UAS-IVS-mCD8-GFP (plasmid #: 26214, Addgene, Cambridge, MA). The construct was then injected into embryos of PBac{y[+]-attP-3B}VK00033 to generate transgenic flies ...
-
bioRxiv - Microbiology 2022Quote: Individual guide RNA (gRNA) sequences (Supplemental Table 1) were cloned into BsmBI-digested lentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang [10]) and resulting lentiviral stocks prepared as previously described [11] ...
-
bioRxiv - Cell Biology 2022Quote: ... K562 CRISPRi cells with or without MICU1(GFP1-10) were nucleofected with a MTCH2 targeting guide in the pX458 backbone (Addgene plasmid # 48138) using the Lonza SF Cell Line 96-well Nucleofector Kit (V4SC-2096) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 × 106 cells of each cell line were electroporated with a mixture of 10 μg of plasmid pEGFP-D50 lamin A (Addgene plasmid #17653) that had been linearized with EagI and 1 μg of pBABE-puro (Addgene plasmid #1764 ...
-
bioRxiv - Developmental Biology 2022Quote: ... HEK293T cells at 70-80% confluency in 10 cm dishes were transfected with the insert construct plus 3rd generation packaging plasmids: pMD2.G (3 μg, Addgene plasmid #12259), psPAX2 (6 μg ...
-
bioRxiv - Biophysics 2023Quote: ... followed by ligation in place of the mApple sequence in the mApple-CD36-C-10 vector (Addgene, Watertown, MA plasmid # 54874 (5)) ...
-
bioRxiv - Cell Biology 2023Quote: ... The fragments of bPAC and TGNP were amplified from cytoplasmic-bPAC (a gift from Dr. Reiter lab) and pmApple-TGNP-N-10 (Addgene plasmid #54954), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids used for tdTomato-Tau overexpression and the tdTomato-C1 control plasmid were a gift from Michael Davidson: tdTomato-MAPTau-C-10 (Addgene plasmid #58112), tdTomato-MAPTau-N-10 (Addgene plasmid #58113 ...
-
bioRxiv - Immunology 2023Quote: ... 293T cells were transfected with 10 ug of lenti-CRISPR-V2-CRE construct along with packaging plasmid 6 ug of PsPAX2 (Addgene, Cat #12260) and 3.5 ug of PmD2.G (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... in the canal was generated by microinjection of plasmid pWD285 at 10 ng/µL concentration with coinjection markers pCFJ90 (Addgene Plasmid #19327) and pCFJ104 (Addgene Plasmid #19328 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were then injected bilaterally with 500 nl of AAV-CaMKIIa-ChR2-EYFP (Addgene, #50469, 2.3 x 10^13 particles per ml) in the secondary motor cortex (AP ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Microbiology 2021Quote: ... the open reading frame was amplified by PCR from the pDONR223 SARS-CoV-2 NSP5 plasmid (Addgene, #141259, a gift from Fritz Roth [32]), including an ATG start codon in the forward primer and a TAA stop codon in the reverse primer (MPro_Fw ...
-
bioRxiv - Immunology 2020Quote: ... pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-SARS-CoV-2-S-RBD-sfGFP plasmids were gifts from Erik Procko (Addgene plasmids #145163 and #141184). pGBW-m4134096 encoding for SARS-CoV-2 M protein was a gift from Ginkgo Bioworks (Addgene plasmid #152039).
-
bioRxiv - Neuroscience 2023Quote: ... Michael Ward and the 2 CLYBL targeting TALEN plasmids (pZT-C13-R1 and pZT-C13-L1, gifts from Jizhong Zou Addgene.org: #52638 and 52637, respectively) by the same method with the Neon Transfection System (40) ...
-
bioRxiv - Neuroscience 2023Quote: Foreskin fibroblasts were transfected with the AAVS1-DOX-KRAB-dCAS9 plasmid and the 2 AAVS1 Talen plasmids (Gifts from Danwei Huangfu, Addgene plasmid # 59025 and 59026) using the Neon Transfection system (38) ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2019Quote: ... CDC45: guide#1 GCATCAGGGTCGGGCTCTGA and guide#2 GCTCTGTCCTCCCTCAACGG) were inserted into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene plasmid #42335, a gift from Feng Zhang) via BbsI restriction site ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Molecular Biology 2022Quote: ... Conditional knockout cells were generated by infection with media from a confluent 10 cm dish of 293T cells transfected with 3 µg pCL-Eco (Addgene, 12371 ref (17)) and 3 µg MSCV CreERT2 puro (Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... HEK 293T cells in 10-cm dishes were transfected at 80% confluence with the lentiviral plasmid pLenti-CMV-Puro (Addgene plasmid no. 17452) containing the gene of interest (2 mg ...
-
bioRxiv - Cell Biology 2019Quote: To generate clonal cell lines that are deficient for SURF4, a sgRNA targeting SURF4 exon 2 (SI Appendix, Table S1) was cloned into the PX459 plasmid (Addgene: 62988, a gift from Feng Zhang) as previously described (95) ...
-
bioRxiv - Neuroscience 2021Quote: ... were performed over a 5 min period with 1 µL of AAV9-hSyn-Cre (Titer ≥ 1×10¹³ vg/mL, Addgene, Cat. No. 105553-AAV9) or un-injected ...
-
bioRxiv - Genetics 2022Quote: ... the NotI/XbaI PCR fragment of eggpl-CDS (GFP tag) was cloned into the NotI/XbaI sites of pJFRC28-10 × UAS-IVS-GFP-p10 vector (Addgene Plasmid, cat. no. 36431). The primer pairs used for PCR validation were as following:
-
bioRxiv - Neuroscience 2023Quote: ... A microsyringe (Nanoject) was used to inject 0.75 µL of AAV5-Syn-GCaMP6f-WPRE-SV40 (Addgene, injected titer of 1.3×10^13 parts/ml) unilaterally into the mPFC (1.6 mm anterior ...