Labshake search
Citations for Addgene :
1551 - 1600 of 1708 citations for KGF 2 FGF 10 Human 171a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: HEK293 cells were transfected with a mixture of the 3rd generation lentiviral packaging plasmids containing: 2 μg of Rev (pRSV-Rev, Addgene #12253), 2 μg of Gag and Pol (pMDLg/pRRE ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Genomics 2023Quote: ... the entry vector was constructed by adding a bcl-2 splice acceptor and four SV40 polyA-signals to a plasmid backbone based on pSMART (Addgene #49157) containing a green fluorescent protein (GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Neuroscience 2023Quote: ... The construct encoding SARS-CoV-2 matrix (M) protein was cloned by PCR amplification of M cDNA from the pDONR 207 SARS-CoV-2 M plasmid (Addgene #141274) using a Forward primer inserting a restriction site for EcoRI and a reverse primer bearing a restriction site for BamHI and a Myc tag ...
-
bioRxiv - Microbiology 2023Quote: ... HUDEP-2 were transduced at an MOI <1 with lentivirus prepared from pXPR_101 (lentiCas9-blast, gift from Feng Zhang, Addgene plasmid 52962) and selected with blasticidin ...
-
bioRxiv - Microbiology 2023Quote: IDT gBlock gene fragments encoding WT and mutant SARS-CoV-2 Mac1 were cloned into a BamHI- and EcoRI-linearized pLVX-EF1alpha-nCoV2019-nsp13-2xStrep-IRES-Puro (Addgene, 141379) by Gibson Assembly Cloning reaction (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... sapiens beta-2-adrenergic receptor used as a control in BRET2 experiments was a gift from Robert Lefkowitz (Addgene plasmid #14697). Mm Arr-2 (NP_796205.1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... self-complementary single-stranded DNA oligos (Supplementary Table 2) were annealed and cloned into AgeI/EcoRI sites of Tet-pLKO-puro vector (Addgene, #21915). Tet-pLKO-puro vectors were packaged into a lentivirus system with pCMV-VSV-G (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... We expressed the soma-targeted opsin ST-ChrimsonR 43 in excitatory neurons by injecting a virus (1012 titer; AAV2/2 camKII-KV2.1-ChrimsonR-FusionRed; Addgene, plasmid #102771) into the craniotomy ...
-
bioRxiv - Neuroscience 2023Quote: Viral injections were performed postnatally at P1-2 with in-house produced according to or commercially available viral vectors AAV-php.eB-hSyn-gCamp7f (Addgene Plasmid #104488) or AAV-php.eB-S5E2-ChR2-mCherry (Addgene Plasmid #135634 ...
-
bioRxiv - Microbiology 2023Quote: ... and pRN-Luc (50 ng) reporter plasmids in combination with S protein expressing plasmids pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Genomics 2024Quote: ... DNMT1 and respective mutants (Table 2) were cloned into the pMXs-IRES-blasticidin retroviral vector (a gift from David Sabatini, Addgene #72876) by EcoRI and XhoI restriction sites without an affinity tag ...
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...
-
bioRxiv - Neuroscience 2024Quote: ... that was first PCR amplified using custom primers (see Table 2) from a plasmid containing lexAop2 (lexAop2-myr-4xSNAPf, RRID: Addgene 87638) and then restriction digested using HindIII and PspXI (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... was mixed in a 1:10 ratio with AAV5-syn-GCaMP6s and injected into PM and AAV5-Syn-SIO-eOPN3-mScarlet (2−1013 gc/mL; Addgene #125713) was injected into either LP ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2018] genomic DNA using RLO336/RLO338 and RLO337/RLO339 primers (Table 2) which introduce sequences homologous to the regions flanking the SacI and HindIII sites of pRG216 (Addgene #64528) [Gnügge and Rudolf 2017] ...
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... were seeded in DMEM with 10% FBS and transfected with the lentivirus vectors along with pCMV-VSV-G (Addgene, 8454), pRSV-Rev (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... injected bilaterally in Gpe with a retrogradely transported Cre-expressing AAV (350nl AAVrg-hsyn-Cre-eGFP, titer 1.3 x 10^13, Addgene 105540) (AP ...
-
bioRxiv - Neuroscience 2021Quote: ... A pulled glass micropipette attached to a nanoinjector (MO-10, Narishige) was used to inject 400nL of pGP-AAV9-syn-FLEX-jGCaMP7s-WPRE (Addgene) virus at a depth of 4.8mm DV at a rate of 100 nL/min ...
-
bioRxiv - Cell Biology 2022Quote: ... 5.25 μg of transfer plasmid (LentiGuide-Hygro with 10-target or 20-target mgRNA) was mixed with 0.75 μg of pMD2.G (Addgene #12259) and 1 μg of psPAX2 (Addgene #12260) ...
-
bioRxiv - Cell Biology 2022Quote: ... Vectors carrying 10-target or 20-target mgRNAs were made by cloning mgRNAs into the LentiGuide-Hygro plasmid (Addgene #139462). In short ...
-
bioRxiv - Neuroscience 2020Quote: ... a series of 6 - 10 microinjections (50 - 100 nL each, 200-300 μm depth) of AAV5.Flex.ArchT.tdTomato (Addgene, #28305-AAV5) were delivered along the posterior to anterior axis of RSC (2.0 to 4.0 mm posterior ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Molecular Biology 2022Quote: SVF cells were isolated as above and on the same day a confluent 10 cm dish of 293T cells were transfected with 1.5 µg psPAX2 lentiviral packaging vector (Addgene 12260), 1.5 µg pMD2.G envelop plasmid (Addgene ...
-
bioRxiv - Microbiology 2022Quote: HEK293T seeded in 10-cm dishes were co-transfected with lentiviral packaging plasmid psPAX2 (gift from Didier Trono, Addgene #12260), lentiviral vector pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase (gift from Ethan Abela ...
-
bioRxiv - Cell Biology 2022Quote: ... organoid fragments were washed and resuspended in Opti-MEM supplemented with Y-27632 (10 µM) and 10µg of pSPgRNA plasmid together with the frame selector plasmid pCAS9-mCherry-Frame +1 (Addgene #66940) and the mNEON targeting plasmid (a kind gift from V ...
-
bioRxiv - Cell Biology 2019Quote: ... Annealed oligos were diluted 1/40 and 1 μl of insert was ligated into 10 ng of digested vector (pU6-sgRNA EF1Alpha-puro-T2A-BFP, Addgene plasmid #60955 digested with BstXI and Blpl ...
-
bioRxiv - Neuroscience 2020Quote: ... RFP-GFP-LC3-encoding retrovirus (9.3×10 TU/mL, produced at the Molecular Tools Platform at the CERVO Brain Research Center based on plasmid #21074, Addgene, kindly provided by Dr ...
-
bioRxiv - Genetics 2020Quote: ... Plasmids generated for this work for heat shock Cas9 expression (pJJF152) and proof of concept sgRNAs (targeting SECGFP, dpy-10, sqt-3) will be available from Addgene as indicated in a supplementary table or for specific sgRNAs upon direct request from the authors.
-
bioRxiv - Cancer Biology 2021Quote: 293T cells (1.5 x 106 in a 10 cm Petri dish) were transfected with lentiviral plasmids together with pVSVg (Addgene, 8454) and psPAX2 (Addgene ...
-
bioRxiv - Immunology 2022Quote: A375-MR1-Cas9 cells generated using the previously described cell line (10) and Lenti Cas9-Blast plasmid (Addgene, Cat#52962) were transduced at 0.3 MOI by both part A and B of the pooled Human GeCKO v2 CRISPR library (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... using an ultra-fine dental drill and inserted a glass pipette backfilled with AAV2-CamkIIa-hChR2(H134R)-EYFP (titer: 3×10¹² viral genomes per ml, 26969-AAV2, Addgene). AC was approached similar to extracellular recordings ...
-
bioRxiv - Neuroscience 2022Quote: ... CRF1-cre mice were injected with 500 nL/hemisphere of AAV5-hSyn-DIO-eGFP (50457-AAV5; titer ≥ 7×10¹² vg/mL, Addgene) into the VTA (ML ±0.60 ...
-
bioRxiv - Neuroscience 2022Quote: ... Vgat-ires-Cre mice were injected with AAV5/pAAV-EF1a-DIO-hChR2(H134R)-mCherry (Addgene, titer of 1.4×10^13) at left MPO (AP -3.1 mm ...
-
bioRxiv - Microbiology 2023Quote: ... cerevisiae BY4741 as described in the methods of Bao.10 The pCRCT plasmid was a gift from Huimin Zhao (Addgene plasmid # 60621 ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral particles were produced in HEK293T cells by transfecting a 10 cm plate with 15 µg packaging plasmid psPAX2(Addgene), 5 µg envelope plasmid pMD2.G (Addgene) ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T-LentiX cells were co-transfected for 12 h with 10 µg psPAX2 (kind gift from Didier Trono, Addgene #12260), 2.5 µg pMD2.G (kind gift from Didier Trono ...
-
bioRxiv - Neuroscience 2024Quote: ... animals were injected bilaterally in the mPFC with an anterograde Cre-dependent AAV5-hSyn-DOI-hM3Dq-mCherry (7×10¹² vg/mL, plasmid #44361, Addgene) for RHA rats (hM3Dq-group ...
-
bioRxiv - Molecular Biology 2024Quote: ... Annealing reactions were diluted 1:10 with water and then 1µL was used to ligate into 100ng of BsmBI digested pLentiGuidePuro vector (Addgene #52963) in 1x T4 DNA Ligase Buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two gRNAs targeting Exon 1 (targeting sequence GGGCGCGCTACCTGTCTCCG) and Exon 10 (targeting sequence GAACTGGACTTTGAAAGAGG) were cloned in BPK1520 (Addgene #65777) and transfected with Amaxa Nucleofector II together with BPK4410 ...
-
bioRxiv - Neuroscience 2024Quote: ... the DNA mixture consisted in 20 μg of specific DNA and 10 μg each of psPax2 and pMD2.G plasmids (from Dr. Didier Trono, Addgene) and 250 mM CaCl2 (in a final volume of 500 ul ...
-
bioRxiv - Biochemistry 2024Quote: ... pQCXIP-BSR-GFP11 and pQCXIP-GFP1-10 were a kind gift from Yutaka Hata 39 (Addgene plasmid #68716 and #68715). pCSDest-TMPRSS2 was a kind gift from Roger Reeves 40 (Addgene plasmid # 53887) ...
-
bioRxiv - Biophysics 2021Quote: Clones of MDCKII expressing GFP-myosin-2-A were created by transfecting cells with pTRA-GFP-NMCH II-A plasmid (Addgene plasmid # 10844). Stable expressing clones were selected via Neomycin resistance (G418) ...
-
bioRxiv - Molecular Biology 2021Quote: ... sgRNA against exon 23 (Table 2) was cloned downstream of the U6 promoter of the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene plasmid # 48138) 61 ...
-
bioRxiv - Biophysics 2022Quote: HEK 293T cells were co-transfected with either pmNG-Mpro-Nter-auto-NLuc or pmNG-Mpro-Nter-auto-L-NLuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (Addgene plasmid # 141370) or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...