Labshake search
Citations for Addgene :
1451 - 1500 of 1708 citations for KGF 2 FGF 10 Human 171a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... that target exon 2 of TREM2 nearby the location of R47H (G>A) and a genomic TTAA were purchased from Addgene. A donor plasmid was made comprising homology arm 1 (HA1 ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 virus-like particles were prepared as previously described (68) by co-transfecting plasmids for N (Addgene 177937); M and E (Addgene 177938) ...
-
bioRxiv - Neuroscience 2023Quote: ... a 50:50 mix of AAV8-CamKII-mCherry (Neurophotonics, Laval University, Quebec City, Canada, Lot #820, titre 2×1013 GC/ml) and AAVrg-CAG-GFP (Addgene, Watertown ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Physiology 2023Quote: ... sgRNA primers were (Table 2) cloned into BbsI-HF linearized pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene, Plasmid Cat. #64324) or pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Biophysics 2023Quote: ... cells transfected with pcDNA3.1-mGL-picALuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (a gift from Nevan Krogan (Addgene plasmid # 141370 ...
-
bioRxiv - Biophysics 2023Quote: ... RRID:Addgene_141370)72 or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (C145A mutant Mpro) plasmid (a gift from Nevan Krogan (Addgene plasmid # 141371 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Genetics 2023Quote: ... Forward and reverse oligos (CACCGCTGCTGCTGCTGCTGCTGGA and AAACTCCAGCAGCAGCAGCAGC) (IDT) for gRNA 2 were cloned into the BSmBI site of pCbh_v5 AAV-CBE C-terminal (Addgene, # 137176) and pCbh_v5 AAV-CBE N-terminal (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... the resistance cassette flanked by LoxP sites (Sec16) was excised by transfection of 2 µg of pBS598 EF1alpha-EGFPcre plasmid (plasmid #11923; Addgene) that encodes for cre recombinase.
-
bioRxiv - Microbiology 2023Quote: ... encoding the Spike glycoprotein of Wuhan SARS-CoV-2 fused to a C-terminal C9 tag (SW) was a kind gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA expression vectors were generated by cloning appropriate DNA oligonucleotides (Supplementary Table 2) into the BbsI restriction sites of the pX459 vector (#62988, Addgene). An empty pX459 vector was used to generate matching control cell lines ...
-
bioRxiv - Biophysics 2023Quote: ... and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids encoding spikes of SARS-CoV-2 variants Delta (Cat. No. 172320) and Omicron (Cat. No. 179907) were procured from Addgene, USA.
-
bioRxiv - Biochemistry 2023Quote: ... cells were transiently co- transfected for 24 h with plasmids for expression of full-length, N-terminal tagged (Flag, HA or tandem Strep tag) BRSK1/2 (or Cys-Ala mutants) and GFP-TAU (Addgene), using 3:1 polyethylenimine (average Mw ...
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... expressing Cas9 nuclease and two gRNAs (see below for sequences) together with the CRIS-PITCh vector pX330S-2-PITCh (63670, Addgene), harboring the Lamin A microhomologies and GFP-Puro or GFP-Neo/Kan insertions ...
-
bioRxiv - Neuroscience 2021Quote: ... Black-6 mice were first injected with 120nL of a retrograde virus encoding Cre (AAVrg-Ef1a-mCherry-IRES-Cre, titer of 1.37 x 10^13, Addgene viral prep # 55632-AAVrg ...
-
bioRxiv - Molecular Biology 2019Quote: The reporter construct (traffic jam enhancer driven GFP_P2A-Blasticidin-resistance harboring 10 intronic boxB sites and 14 upstream UAS sites; plasmid submitted to Addgene) was integrated into chromosomal location chr2L:9,094,918 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The pAR-Ec611 (ArEc-Rev1-611) plasmid harboring medium-error-rate polymerase TP-DNAP1_611 (≥10−6 s.p.b.) was obtained from Addgene (Watertown, MA).
-
bioRxiv - Microbiology 2020Quote: ... 10 μg pQXCIH-TMPRRS2-HA was co-transfected with polyethylenimine (PEI) with 6.5 μg pBS-gag-pol (Addgene #35614) and 5 μg pMD2.G in a 10 cm dish of 70% confluent HEK-293T cells in Opti-MEM I (1X ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids encoding the Spike protein were a mixture of (10 µg) of pcDNA3.1-SARS2-Spike (Addgene plasmid 145032) and (3 µg ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 293 cells were seeded in 10-cm-diameter dishes and transfected with pCMV-dR8.2 dvpr (Addgene plasmid #8455), pCMV-VSV-G (Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2022Quote: Adult male MC4Rlox/lox mice[10] were injected with were injected with pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (Addgene Cat. No. 105545-AAV9) into IL (bregma +0.175 AP ...
-
bioRxiv - Microbiology 2021Quote: ... 15 μg of pMDLg/p RRE and 10 μg of pRSV-Rev packaging plasmids (Addgene #12251 and Addgene #12253) and the pVSV envelope plasmid (Addgene #8454 ...
-
bioRxiv - Microbiology 2021Quote: ... 15 μg of pMDLg/p RRE and 10 μg of pRSV-Rev packaging plasmids (Addgene #12251 and Addgene #12253) and the pVSV envelope plasmid (Addgene #8454 ...
-
bioRxiv - Cell Biology 2021Quote: ... and co-transfected at DIV 10 with the mCherry-GFP-LC3 reporter (gift from Anne Brunet, Addgene plasmid # 110060) and either α-S824 or myc-β4 protein ...
-
bioRxiv - Immunology 2021Quote: ... A plasmid expressing SP140 was made by cloning the purified SP140 cDNA into the p3xFLAG-CMV-10 vector (Addgene) using Gateway techniques (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 uL of a 1:1 mixture of EGFP (AAV9- Hsyn-DIO-EGFP;4.6*10^13 GC/mL; Addgene) and AAV8-GAD1-cre was injected unilaterally into VP ...
-
bioRxiv - Microbiology 2023Quote: ... cerevisiae BY4741 as described in the methods of Bao.10 The pCRCT plasmid was a gift from Huimin Zhao (Addgene plasmid # 60621; http://n2t.net/addgene:60621; RRID: Addgene_60621) and purchased from Sigma.
-
bioRxiv - Neuroscience 2023Quote: Adult mice were stereotaxically injected at 7-10 weeks of age with 600 nl of 1.5×1013 vg/ml AAV1-CKIIa-stGtACR2-FusionRed (AddGene) or 7×1012 vg/ml AAV1-CKIIa-mCherry control at bilateral ACC (antero-posterior (AP ...
-
bioRxiv - Neuroscience 2023Quote: ... a mixture of flexed AAV GFP (pAAV-FLEX-GFP-Virus, titer ≥ 1×10¹³ vg/mL, Addgene 28304-AAV PHPeB) and CamKII-Cre (pENN.AAV.CamKII 0.4.Cre.SV40 ...
-
bioRxiv - Molecular Biology 2023Quote: ... AAVpro 293T cells were cultured in DMEM (FUJIFILM Wako Pure Chemical) supplemented with 10% (v/v) FBS (NICHIREI) and transfected with the pUCmini-iCAP-PHP.eB plasmid (Addgene), pHelper plasmid (Takara Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-hSyn-DIO-hM4D(Gi)-mCherry or AAV5-hSyn-DIO-mCherry (all viruses: 4.2*10^12 gc/ml; Addgene) in the LC (AP ...
-
bioRxiv - Neuroscience 2023Quote: ... After 2 weeks the same procedure was used to injected 200nL of AAV5-hSyn1-SIO-eOPN3-mScarlet-WPRE (3,4 10^12 gc/mL Addgene) at the same previous locations inside the RSC ...
-
bioRxiv - Neuroscience 2024Quote: ... a total volume of 10-20 ul of AAVrg-FLEX-taCasp3-TEVp (titer >1 × 1012 pfu/ml; Addgene 45580) was injected into the medial and left lobes of the livers of AvilCreERT2 mice ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV injections consisted of a 1:10 cocktail of Cre [AAV5-CMV-HI-eGFP-Cre.WPRE.SV40 (Addgene plasmid no. 105545) packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of AAV9.hsyn.FLEX.iGluSnFR.WPRE.SV40 (a gift from Loren Looger, Addgene plasmid # 98931; http://n2t.net/addgene: 98931; RRID:Addgene_98931, 10 vg/mL in water) solution was injected with a blunt tip (30 gauge ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 x 105 HeLa cells were seeded into a 6-well plate and next day transfected with 2 μg of the FLPe recombinase plasmid (Addgene #20733) (Beard et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... two guideRNAs were designed to flank the target exon coding the β1-2 loop (see Table EV1 for primer sequences) and cloned into the guide RNA expression pCFD4 vector (Addgene #49411). The exon of interest and homology arms were cloned into donor template plasmid pHD-ScarlessDsRed (Addgene # 64703 ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...