Labshake search
Citations for Addgene :
1651 - 1700 of 1985 citations for Cis Dcca 100 Ug Ml In Acetonitrile D3 1 Carboxyl 13C2 99%; 1 D 97% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the GCaMP6 virus (AAV1.Syn.Flex.GCaMP6s.WPRE.SV40, Addgene; titre 1.45×1013 genome copies per ml) was injected unilaterally for 10 min using a micromanipulator (Nanoliter 2010) ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-mCherry (Addgene, 50459-AAV8, 1.0 x 1013 vg/ml) was micro-infused in vCA1 bilaterally (500 nL per hemisphere ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV5-hSyn-DIO-mCherry (2.6E+13 vg/ml, 350nl, Addgene catalog # 50459) into the AC and a retrograde Cre virus ...
-
bioRxiv - Neuroscience 2023Quote: ... A unilateral injection of 300nl rAAV2retro-FlpO (AddGene #55637-AAVrg, 1,6.1013 vg/ml) was made in the Pons (AP -0.3 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL, Addgene, 108685) was injected into the MLT (from the bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pAAV.syn.GCamMP6s.WPRE.SV40 (viral titer/ml: 1.3 x 10^13, Addgene 100843-AAV9). For jRGECO and GPHN.FingR.EGFP expression ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... or AAV5-hSyn-DIO-GFP virus (Addgene Cat. No. 50457-AAV5, 7x1012vg/mL). The viral injection procedures were executed as described in [32] ...
-
bioRxiv - Neuroscience 2024Quote: ... The virus is pGP-AAV-syn-jGCaMP8m-WPRE (Addgene 162375, 1.7x1013 GC/mL). The coordinates used were decided according to the mouse brain atlas (Paxinos and Franklin ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV8-hSyn-DIO-mCherry (Control virus; 2.3 x 1013 GC/ML, Addgene). Rats in Experiment 3 received a unilateral infusion of AAV8-rCRHp-iCre (200 nL ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2-hSyn-FLEX-ReaChR-mCitrine (0.3-3.0 × 1013 gc/mL, 50955 from Addgene) was injected bilaterally or unilaterally into the LC of Dbh-Cre mice (-5.5 AP ...
-
bioRxiv - Molecular Biology 2023Quote: The control vector pEGFP was generated by Gibson assembly 106 of the following DNA fragments: the EF-1 alpha promoter (amplified from pEF1a-mRor2WT, Addgene #2261, a gift from Roel Nusse 107) and the EGFP-ori-AmpR fragment (amplified from pCMV_ABEmax_P2A_GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells expressing doxycycline (DOX)-activated DHFR-UBA5 were cotransfected with two plasmids: (1) pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230, a gift from Feng Zhang), for expression of human codon-optimized SpCas9 and sgRNA UBA5 (ACCTACTATTGCTACGGCAA) ...
-
bioRxiv - Immunology 2019Quote: ... were incorporated into two complementary 100-mer oligonucleotides and cloned into a gRNA containing plasmid containing the (NeoR/KanR) cassette (Addgene # 41824). The human codon optimized pCAGGS-Cas9-mCherry was used for gene-editing experiments (a gift from Stem Cell Core Facility at Columbia University) ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 pmol of the oligo mix was added to a 20 μl Golden Gate reaction containing 100 ng destination plasmid (pATT-DEST, Addgene #79770), 10 units BsaI (NEB #R3733) ...
-
bioRxiv - Cell Biology 2021Quote: ... and transfected with 100 ng of the indicated ORF6 expression construct along with either 50 ng of an ER marker (eGFP-Calnexin; Addgene: 57122), 50 ng of a Golgi marker [mTag-β-galactosidase (1-61)] ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA (100 ng/μl) and SEC repair template (20 ng/μl) plasmids combined with Peft-3::Cas9 (60 ng/μl; Addgene #46168) and Pmyo-2::mCherry co-injection marker (2.5 ng/μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resin was washed 6 times with lysis buffer (supplemented with 100 nM USP2 (purified in-house from Addgene plasmid 36894) for de-ubiquitinated TOP2B) ...
-
bioRxiv - Pathology 2021Quote: ... HEK293T cell (2.5 × 106) were seeded in a 100 mm-dish and co-transfected by calcium phosphate with 10 μg pLVTHM/GFP (Addgene 12247), 7.5 μg psPAX2 (Addgene 12260) ...
-
bioRxiv - Neuroscience 2022Quote: ... Experiments with inducible Cre used 2-20 fmol (10-100 ng) pCAG ERT2-Cre-ERT2 (Addgene #3777, Matsuda and Cepko, 2007) per coverslip ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed using 1100 ng of total DNA (500 ng transfer plasmid, 500 ng pCMVR8.74 Addgene plasmid # 22036, 100 ng pCMV-VSV-G Addgene plasmid # 8454) The day before transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... two 5 weeks old rats habituated to tickling underwent unilateral injection of 100 nl at 30 nl/min of AAV2/5.hsyn.eGFP (Addgene, 50465-AAV5) in the insular cortex at the following coordinates ...
-
bioRxiv - Bioengineering 2023Quote: ... the neurons were transduced with 1 µL of an adeno-associated virus serotype 9 (AAV9) carrying a fluorescent calcium ion indicator GCaMP6s under a pan-neuronal human synapsin (hSyn) promoter (AAV9-hSyn::GCaMP6s, Addgene viral prep #100843-AAV9, >1×1013 IU/µL). After 5 days of incubation ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected AAV1-CAG-FLEXFRT-ChR2(H134R)-mCherry (75470, 7×1012 vg/mL, Addgene). For imaging DA dynamics ...
-
bioRxiv - Neuroscience 2020Quote: ... we expressed fluorophores using AAVs (AAV1.CB7.CI.eGFP.WPRE.rBG, University of Pennsylvania Vector Core CS0326, 2.04×1013 GC/ml; AAV8.Syn.Chronos.tdTomato, Addgene 62726 ...
-
bioRxiv - Neuroscience 2022Quote: ... The AAV5.EF1⍺.DIO.hChR2(H134R).EYFP (Addgene; titre: 2.4×1013 genome copies per ml) or AAV5.EF1⍺.DIO.eNpHR3.0.EYFP (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-eGFP (titer ≥ 7×1012 vg/mL; Addgene viral prep #50465-AAV5) as control ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors expressing ChrimsonR (pAAV1-Syn-ChrimsonR-tdT; 2 × 10^13 GC/ml; Addgene) 27 or channelrhodopsin-2 (hChR2 ...
-
bioRxiv - Neuroscience 2022Quote: ... or a control virus AAV9-hSyn-eYFP (Addgene, viral titer 2.8 × 1013 vg/mL) was injected in the NAcSh of WT mice while AAV9-Syn-Flex-GcAMP6f-eYFP (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 26969-AAV1, RRID:Addgene_26969; Addgene, MA, U.S.A.)14 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 26969-AAV1, RRID:Addgene_26969; Addgene, MA, U.S.A.)14 ...
-
bioRxiv - Neuroscience 2023Quote: ... Uchida) or 120nl of mixed AAV9-Ef1a-fDIO-Cre (2.5×1013 vg/ml; Addgene) and AAV2-CAG-Flex-GCaMP6f (1:2 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-hSyn-DIO-mCherry (control, titer 6 × 1012 cfu/ml, 250nl bilateral, #50459, Addgene), AAV5-hSyn-GFP-Cre (titer 3.5 × 1012 cfu/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... Optogenetic inactivation: AAV1 hSyn-SIO-stGtACR2-FusionRed (1.9 × 1013 vg/ml, Addgene, #105677-AAV1); OXTR knock-out ...
-
bioRxiv - Neuroscience 2022Quote: ... Chemogenetic inactivation: AAV2 hSyn-DIO-hM4Di-mCherry (1.5 × 1013 vg/ml, Addgene, #44362-AAV2); Optogenetic inactivation ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 162382-AAV9, RRID:Addgene_162382; Addgene, MA, U.S.A.),
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 162382-AAV9, RRID:Addgene_162382; Addgene, MA, U.S.A.),
-
bioRxiv - Neuroscience 2022Quote: ... a calcium indicator AAV9-hSyn-GCAmp6f-eYFP (Addgene, viral titer 2.8 × 1013 vg/mL) or a control virus AAV9-hSyn-eYFP (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... OXTR knock-out: AAV1 CMV-HleGFP-Cre (1.1 × 1013 vg/ml, Addgene, #105545-AAV1) or AAV2 hSyn-GFP (3.4 × 1012 vg/ml ...
-
bioRxiv - Physiology 2023Quote: ... HyPer7.24 The cDNA of pCS2+MLS-HyPer7 was purchased from Addgene (Plasmid ID: 136470) and was transfected in HAECs using the NeonTM Transfection System (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... or pGP-AAV1-syn-FLEX-jGCaMP7f-WPRE (titre 2.1 x 1013 vg/ml, Addgene). 6s and 7f dopamine recordings were pooled in presented analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV CAG-tdTomato (AAVrgTdT; Addgene 59462-AAVrg; 3μl of 4.6 x 1012 GC/ ml). Mice were split into 3 groups whereby group 1 had both vagi intact ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-dependent pAAV-FLEX-tdTomato (2.1×1013 particles/ml; Addgene viral prep #28306-AAVrg) was injected into the same hemisphere at 0.7 mm anterior to Bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVDJ-EF1α -fDIO-hChR2-EYFP (2.19 x 1013 GC/ml, plasmid RRID:Addgene_55639, Vigene production) or AAV5-EF1α-DIO-EYFP (6.5 x 1012 GC/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) or a control virus (AAV2-hSyn-DIO-EGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... 300uL of AAVrg-Ef1a-mCherry-IRES-Cre-WPRE (Addgene 55632-AAVrg, 1.7x1013 vg/mL) was injected unilaterally into either left NAc (AP ...
-
bioRxiv - Neuroscience 2023Quote: ... pCyPet-Rac1(T17N)) and AAV-GFP (pAAV.CMV.PI.EGFP.WPRE.bGH; 1.6x1013 vg/ml) were purchased from Addgene. AAV-GFP was diluted to match the concentration of AAV-Rac1-DN.
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 0.2uL of pAAV5-hSyn-hM4D(Gi)-mCherry (≥ 7 x 1012vg/mL, Addgene # 50475), pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (viral titer/ml: 3.2 x 10^13, Addgene 100854-AAV9), pCAG.DIO.GPHN.FingR.EGFP2F (viral titer/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, 44361-AAV8, 2.9 x 1013 vg/ml) or AAV8-hSyn-DIO-mCherry (Addgene ...