Labshake search
Citations for Addgene :
1501 - 1550 of 1985 citations for Cis Dcca 100 Ug Ml In Acetonitrile D3 1 Carboxyl 13C2 99%; 1 D 97% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-EF1a-DIO-eYFP (1.3×1013 GC/ml, Addgene) were using a Nanoject III instrument (Drummond ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV5-EF1a-DIO-eYFP (1.0 × 10e13 GC/ml, Addgene) were injected into POm and S1 of Rbp4-cre mice ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV5-hSyn-eNpHR3.0-eYFP (2.3 × 10e12 GC/ml, Addgene) into the SP5i (AP -6.6 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-EF1α-DIO-hM3Dq-mCherry (2.4×1012 vg/ml, Addgene plasmid #50460-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: AAV1-CAG.FLEX.GFPsm_myc.WPRE.SV40 (1.12E+13 GC/ml) was purchased from Addgene. EnvA+ RVdG-5PSD95eGFP-SynPhRFP (1.55E+08 IU/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-Ef1a-DIO EYFP (∼1x1013 GC/ml, 300 nl, Addgene) was bilaterally injected into VTA and SN of 10 wk old mice ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pAAV9.CAG.Flex.GCaMP6s.WPRE.SV40 (1.9 x 1013 vg/ml, Addgene) or pGP-AAV1-syn-FLEX-jGCaMP7f-WPRE (titre 2.1 x 1013 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: AAV-hSyn-DIO-mCherry (Addgene #50459-AAV8; 2,1.1013 vg/ml) was injected bilaterally into the DG of 10-week-old male PenkCre;Ai6 mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 200nL of AAV9-CaMKII-Cre (10^12 gcp/mL Addgene) was injected at a depth of 300µm in each craniotomies ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, 44362, vg/mL) or pAAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-jGCamp7s (Addgene 104491, titer; 2.5 x1013 pfu/ml). AvilCreERT2 mice received a total volume of 20 ul of viral injection into the medial and left lobes of the livers ...
-
bioRxiv - Neuroscience 2024Quote: - AAV8 hSyn-DIO -mCherry (2.3 × 1013 gp/ml) (Addgene #50459)
-
bioRxiv - Neuroscience 2021Quote: ... Thirty seconds after introduction of the capillary tube 100 nl of rAAV-CAG-GFP (Addgene, 37825-AAVrg) was infused into the spinal cord over 2 minutes ...
-
bioRxiv - Genetics 2022Quote: ... The resulting 100-bp fragment was assembled into an AflII-linearized gRNA empty vector (Addgene, ID#41824) using the Infusion assembly protocol (TaKaRa Bio) ...
-
bioRxiv - Genetics 2019Quote: ... HEK293T cells were transfected with a mixture of 100 ng of plasmid encoding sgRNA (pRG2; Addgene #104174) and 100 ng of plasmid encoding SpCas9 (pRGEN-Cas9-CMV/T7-Puro-RFP ...
-
bioRxiv - Genetics 2020Quote: ... The yeast were then transformed with 100 ng of CRISPR-Swap plasmid (pFA0055-gCASS5a, Addgene plasmid # 131774) and 1 μg of DNA repair template amplified either from BY ...
-
bioRxiv - Genomics 2022Quote: ... The resulting 100-bp fragment was assembled into an AflII-linearized gRNA empty vector (Addgene, ID#41824) using the Infusion assembly protocol (TaKaRa Bio) ...
-
bioRxiv - Genetics 2023Quote: ... We used lentiviral vectors (100 MOI) designed explicitly for this purpose: lentiCRISPR v2-mCherry (Addgene plasmid # 99154), a gift from Agata Smogorzewska ...
-
bioRxiv - Biochemistry 2022Quote: ... The construct was packaged into lentivirus using HEK293T cells and delivered into target cells together with pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid no. 26730) for tetracycline inducible expression ...
-
bioRxiv - Biochemistry 2022Quote: ... These GFP positive cells were transduced with lentiviral particles for pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid number 26730) for tetracycline inducible expression and selected using hygromycin (200μg/ml) ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453; a gift from Bob Weinberg) (Stewart et al. ...
-
bioRxiv - Genomics 2019Quote: ... We co-transfected the pLentiRNACRISPR constructs together with a GFP expression plasmid in a 2:1 molar ratio. The guide RNA length comparison (Supplementary Fig. 1d) was done using previously published RfxCas13d constructs (Addgene 109049 and 109053), except that we removed the GFP cassette from the RfxCas13d plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Neuroscience 2020Quote: ... a pair of complementary 20 bp oligos for each guide RNA sequence was annealed and cloned into pX330 (Addgene 42230; for guide 1) or pSG (a shuttle vector ...
-
bioRxiv - Cell Biology 2022Quote: Dynamin-1-mCherry and dynamin-1(K44A)-mCherry were made by replacing the GFP from WT Dyn1 pEGFP and K44A Dyn1 pEGFP (Addgene #34680 and #34681), respectively ...
-
bioRxiv - Developmental Biology 2019Quote: ... We amplified PCR fragments with the respective primers (see Table S1 for information about the gRNAs and Table S2 for primer sequences used) and 1 ng pCFD6 (Addgene, Cat. No: 73915) as template utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Developmental Biology 2021Quote: ... with the only exception of ΔR2 and ΔF_ALL_Inv that were generated by using a pair of sgRNA. The guide sequences (listed in Supp. Table 1) were then cloned in px459 CRISPR/Cas9 vector (Addgene Cat. N. 62988), previously digested with Bbs1 ...
-
bioRxiv - Immunology 2020Quote: A short-guide RNA targeting the BFL-1 transcriptional start site was cloned into the BsmbI-digested dCas9-KRAB-GFP (Addgene #71237, RRID: Addgene_71237) or lentiguide-puromycin (Addgene #52963 ...
-
bioRxiv - Neuroscience 2023Quote: ... each of these viruses were mixed in a 4:1 ratio with AAV8-Ef1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (Addgene; Watertown, MA, USA) and injected with 300 nL per side ...
-
bioRxiv - Biophysics 2023Quote: The full-length α-synuclein monomer (1−140) expression plasmid (pET21a-alpha-synuclein) was a gift from Michael J Fox Foundation MJFF (Addgene plasmid # 51486). The α-synuclein monomer was expressed and purified following the previous method20,21 ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Cell Biology 2023Quote: ... pcDNA3.1-myc-OGA(1-400) and (344)pcDNA3.1(+)-HA-nLaG6-(EAAAK)4-OGA(544-706)15 (gift from Christina Woo; Addgene plasmid 168095 and 168197). Additionally ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Molecular Biology 2024Quote: ... The synthetic sgRNA oligo pair complementary to exon 1 was designed and cloned into lentiCRISPRv2 vector (Addgene #52961, gift from Dr. Feng Zhang)143 following the published protocol.49 For virus production ...
-
bioRxiv - Cell Biology 2024Quote: ... expressing a gRNA targeted against hTUBA1B (gGATGCACTCACGCTGCGGGA) and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were transiently transfected with green fluorescent protein (eGFP) (0.25 µg of cDNA/ml) and PIEZO1 channel plasmid (Addgene, #80925, 3 µg of cDNA/ml). For control experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2-hsyn-hM3Dq-mCherry (Addgene #50474-AAV2; 7.38 ×1012 vg/ml) was injected into the bilateral sensorimotor cortex at four sites (500 nL/point ...
-
bioRxiv - Neuroscience 2020Quote: AAV2-hSyn-DIO-hM4Di-mCherry (4.6 × 1012 vg/ml, Addgene, USA)
-
bioRxiv - Neuroscience 2020Quote: ... AAV2-hSyn-DIO-hM3D(Gq)-mCherry (5.8 × 1012 particles/mL; Addgene, Catalog number 44361-AAV2 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-flex-ChR2-Tdtomato (Addgene, titer 2*1012/ml, 0.5 μl) or AAV1-flex-ChR2-mCherry (Charite Vector core ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-AAV-CAG-tdTomato (Addgene, 7×10^12 gc/ml), Cholera toxin subunit B CF-640 (Biotium ...
-
bioRxiv - Neuroscience 2020Quote: pAAV.Syn.GCaMP6f.WPRE.SV40 virus (titer: 2.2 × 1013 GC/mL, obtained from AddGene, USA) was injected into dorsal hippocampus (AP -2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 105622-AAV1, RRID:Addgene_105622), (3 ...
-
bioRxiv - Neuroscience 2020Quote: ... carrying the fluorescent calcium indicator GCaMP6f (AAV.Syn.Flex.GCaMP6f.WPRE.SV40, 1E13 particles/ml, Addgene) into the left VTA (AP ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV5-hSyn-DIO-mCherry (1012 particles/mL, plasmid #50459, Addgene) in the SNc of TH::Cre rats (20,21) ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 27056-AAV9, RRID:Addgene_27056),