Labshake search
Citations for Addgene :
1551 - 1600 of 1985 citations for Cis Dcca 100 Ug Ml In Acetonitrile D3 1 Carboxyl 13C2 99%; 1 D 97% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1, RRID:Addgene_18917), and
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 20298-AAV9, RRID:Addgene_20298),
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1013 GC/ml (Addgene viral prep # 104487-AAV1, RRID:Addgene_27056)15.
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669, 7 × 1012 VG/ml) were made unilaterally into right spinal cord gray matter at C7/C8 (0.5 mm lateral ...
-
bioRxiv - Neuroscience 2023Quote: ... and pAAV-CAG-GFP (Addgene, 37825-AAVrg, 7.0×1012 vg/mL). In a subset of the brains ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV viruses were pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene, 105554-AAV1, 1.9×1013 vg/mL), AAV9-syn-RFP (SignaGen ...
-
bioRxiv - Neuroscience 2023Quote: ... and pAAV-hSyn-EGFP (Addgene, 50465-AAV1, 1.1×1013 vg/mL). In different brains ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1.syn.jGCaMP7s.WPRE.SV40 from Addgene, lot v50167, titer 2.7E13 GC/mL) was then injected at 2 sites within the durotomy ...
-
bioRxiv - Systems Biology 2023Quote: ... we first digested mitochondrial matrix-localizing HyPer7 (pCS2+MLS-HyPer7, RRID:Addgene_136470) with BamH1 and XhoI and ligated into our lentiviral backbone (13) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVrg-hSyn-eGFP (RRID:Addgene_50465, 300 nl at 2x 1013 GC/ml) were injected into the pontine nuclei to regrogradely label PT neuron in the motor cortex ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg-hSyn-Cre (≥ 1.8 x 1013 vg/ml, Addgene # 105553) virus was bilaterally infused onto the iCA1 (AP-2.75 ...
-
bioRxiv - Neuroscience 2023Quote: ... 7×10¹² genome copies per ml) viruses were purchased from Addgene.
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, 44361, vg/mL) were injected in Nav1.8 Cre animals in in the NTS (from bregma ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-GFP (Addgene 51502-AAVrg, titer; 2.3 x1013 pfu/ml), AAVrg-FLEX-jGCamp7s (Addgene 104491 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T cells were co-transfected using lentiviral packaging plasmids (psPAX2 and pMD2.G) with a PLKO.1-blast plasmid (Addgene, Cambridge, MA, USA, #26655) containing shSmad2 or shYAP ...
-
bioRxiv - Cancer Biology 2019Quote: ... H2B-RFP in pENTR1A (w507-1) and pENTR1A-GFP-N2 (FR1) were gifts from Eric Campeau and Paul Kaufman (Addgene plasmids # 22525 and # 19364). H2B-GFP plasmids were transduced using lentivirus infections.
-
bioRxiv - Cancer Biology 2022Quote: For CRISPR/Cas9 knockout AMPK sgRNA plasmids targeting exon 1 of AMPK α1 and αβ (pX462-hPRKAA1-gRNA, pX462-hPRKAA2-gRNA, #74374-74377) were purchased from Addgene (Watertown, MA, USA). LNT-229 ...
-
bioRxiv - Cancer Biology 2022Quote: 293T cells were transfected with packaging plasmids (8 μg of pCMV-dR8.2 dVPR and 1 μg pCMV-VSV-G, a gift from Robert Weinberg, Addgene plasmid #8455 and 8454, respectively) along with shRNA plasmids (8 μg ...
-
bioRxiv - Cancer Biology 2022Quote: ... 90% confluent HEK29T3 cells in 100 mm plates were transfected with pMD2.G (1.5 μg; Addgene plasmid # 12259), psPAX2 (3.0 μg ...
-
bioRxiv - Neuroscience 2022Quote: ... 70–100 nl of AAV5-CaMKIIa-hChR2(H134R)-EYFP (UNC vector core, Karl Deisseroth virus stock/ Addgene #26969) was injected into either the ventral (AP = −2.8 – −3.1 mm ...
-
bioRxiv - Synthetic Biology 2020Quote: The library was synthesized by Agilent and then resuspended in 100 uL of elution buffer before cloning into plasmid pLibacceptorV2 (Addgene ID no. 106250). The transcription factor spacing library was ordered separate from the other libraries ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... LCMV-GP1-100 was cloned into MSCV-IRES-Thy1.1 DEST vector (63) (MSCV-IRES-Thy1.1 DEST was provided to Addgene by Dr ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2019Quote: ... CDC45: guide#1 GCATCAGGGTCGGGCTCTGA and guide#2 GCTCTGTCCTCCCTCAACGG) were inserted into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene plasmid #42335, a gift from Feng Zhang) via BbsI restriction site ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Sequence maps are included in File S2 and plasmids useful for constructing additional two-gene expression systems (pJS101 and pJS102, Table 1) are available from AddGene (deposit numbers 118280 and 118281) and have been verified by whole-plasmid sequencing [33].
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with 100 nL of AAV virus expressing GCaMP6s into three locations within primary visual cortex (AAV1.Syn.GCaMP6f.WPRE.SV40; Addgene 100837-AAV1) at two depths (150 and 300 µm ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 100 ng/µl of Cas9 mRNA transcribed from the linearized MLM3613 plasmid (Addgene 42251; Dahlem et al., 2012). GFP-positive individuals were crossed to wildtype ...
-
bioRxiv - Neuroscience 2023Quote: ... a glass pipette (tip diameter: ∼100 µm) containing the retrograde AAV-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene #51085) was slowly lowered into the IC at a rate of 1 µm/s using a micromanipulator (Sutter MP-285) ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-DIO-hM4D(Gi)-mCherry (≥8 × 1012vg/mL, Addgene #44362). The needle remained in place for an additional 5 minutes after each injection to allow for diffusion of the virus and then the needle was slowly removed from the brain ...
-
bioRxiv - Neuroscience 2021Quote: AAV5-CamKIIa-hChR2 (H134R)-EYFP (titer: 1.5 × 1013 GC/ml, Addgene, 26969) was stereotaxically injected into S2 or M1 in mice aged 4-6 weeks ...
-
bioRxiv - Neuroscience 2021Quote: ... Addgene) or eYFP alone (AAV2-CaMKIIa-EYFP, 2.0 × 1012 Vg/mL, Addgene; AAV5-CaMKIIa-EYFP ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV1-Syn-FLEX-GCaMP6s (Addgene: 100845-AAV1, title: 2.5×1013vg/ml) was delivered into the dLGN of 6 wild type C57BL/6J mice (3 male ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Neuroscience 2021Quote: - AAV1-hsyn1-SIO-stGtACR2-FusionRed (120-200nl, 0.9-1.8e12 GC/ml, Addgene) - for stGtACR2 inactivation
-
bioRxiv - Neuroscience 2020Quote: ... 7 mice) or AAV2-hSyn-DIO-mCherry (4.7 × 1012 particles/mL; Addgene, Catalog number 50459-AAV2 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 400nl of AAV9-CaMKIIa.C1V1(t/t).TS.EYFP (≥1013 CG/ml, Addgene). Orexin promoter virus expression specificity has been characterized previously (González et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV8.hSyn.DIO.hM3D(Gq).mCherry (Addgene; titer 4.8×1012 genome copies per ml) was used for chemogenetic experiments.
-
bioRxiv - Neuroscience 2022Quote: ... AAV9.EF1a.DIO.eNpHR3.0.EYFP.WRE.hGH (v26966; 2.2 × 1013 GC/mL) was obtained from Addgene. CAV-2.Cre (4.0 × 1011 GC/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... The control virus (AAV8-hSyn-DIO-mCherry, 2.3×1013 GC/mL, Addgene) was injected according to the same procedure ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.FLEX.PKIα.IRES.nls.mRuby2 (1.35×1013 GC/ml, packaged by Vigene Biosciences, Addgene #63059)109 was co-injected with AAV1.hSyn.Cre.WPRE.hGH and AAV8.CAG.FLEX.EGFP ...
-
bioRxiv - Neuroscience 2022Quote: ... a virus expressing GCaMP6s (AAV9.Syn.GCaMP6s.WPRE.SV40, ~1.9 × 1013 GC/ml; Addgene # 100843) was injected unilaterally in the A13 while for DREADD experiments viruses for reversibly activating (AVV8-Syn-hM3D-Gq-mCherry ...
-
bioRxiv - Neuroscience 2022Quote: ... for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml, Addgene) for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml ...
-
bioRxiv - Neuroscience 2019Quote: ... or AAV5-hDlx-GqDREADD-dTomato (3.15×10^15 virus molecules/mL) (Addgene plasmid # 83897 ...
-
bioRxiv - Cell Biology 2021Quote: HyPer7 (pCS2+MLS-HyPer7, a gift from Vsevolod Belousov, Addgene plasmid #136470)) is an ultrasensitive fluorescent ratiometric probe for detection of mitochondrial H2O2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 26 or AAV5-hSyn-DIO-mCherry (2.3 × 10^13 GC/ml; Addgene) was bilaterally injected into either the mPFC (AP:1.7 ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5μl pGP-AAVrg-syn-jGCaMP7f-WPRE virus 25 (1.85× 1013GC/ml; Addgene) was infused into the NAc (A/P ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVrg-Ef1a-fDIO-mCherry (2.2 × 1013 vg/ml, 100nl unilateral, #114471, Addgene), AAV9-EF1a-fDIO-Cre (1.3 × 1013 vg/ml ...