Labshake search
Citations for Addgene :
101 - 150 of 985 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of mEOS3.2 (from Addgene #54696) was fused within the cDNA of (i ...
-
bioRxiv - Neuroscience 2020Quote: ... Mus musculus Cdc50a cDNA and mCherry (Addgene) sequences were amplified by overlap PCR and subcloned into the AAV-CAG-GFP (Addgene ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA’s were obtained from commercially available (AddGene) sources and variants were introduced by performing overlapping PCR ...
-
bioRxiv - Neuroscience 2019Quote: Green CEPIA1er cDNA was purchased from Addgene. Imaging of ER calcium levels using G-CEPIA1er was performed in the same manner as fura-2 imaging however single-wavelength excitation at 488nm was used.
-
bioRxiv - Cell Biology 2023Quote: ... we amplified the SERCA2b cDNA from Addgene plasmid #75188 using SERCA specific forward 5’-GGGAGATCTATGGAGAACGCGCACACCAAGACGG-3’ and reverse 5’-GGGGTCGACTCAAGACCAGAACATATCGCTAAAGTTAG-3’ primers with overhanging BglII and SalI sites for pEGFP-C1 vector insertion ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was obtained from Addgene (Plasmid #71458) and cloned into pLVX-IRES-mCherry (Takara Bio).
-
bioRxiv - Cancer Biology 2024Quote: All cDNAs were either cloned from Addgene plasmids or synthesized as indicated below ...
-
bioRxiv - Biochemistry 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Pooled Library #1000000048),pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid # 42230), and lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2022Quote: ... The m1 mammalian expression vector was constructed in two steps from mEos3.2-N1 (Addgene #54525). First an existing BsaI site in mEos3.2-N1 was removed by introducing a point mutation at nucleotide position (3719 ...
-
bioRxiv - Neuroscience 2019Quote: ... and the other two were cloned using the same plasmid and plasmids acquired from Addgene. Using the orx.GCaMP6s virus ...
-
bioRxiv - Cell Biology 2022Quote: ... of two PCR based fragments generated by amplifying the pN-PITCh-GFP (Addgene plasmid #127888) vector backbone using primers 5’ caaacacgtacgcgtacgatgctctagaatg and 5’ tgctatgtaacgcggaactccatatatggg and the Rac1 sequence flanked Puro-GFP cassette from pN-PITCh-GFP using primers 5’ccgcgttacatagcatcgtacgcgtacgtgtttggGGCCCAGCGAGCGGCCCTGAtgaccgagtacaagcccacg and 5’cattctagagcatcgtacgcgtacgtgtttgggACCACACACTTGATGGCCTGCAtcttgtacagctcgtccatgccgag.
-
bioRxiv - Cancer Biology 2020Quote: Two distinct shRNA for each target gene were cloned into pLKO.1 puro (Addgene #8453) according to the corresponding protocol ...
-
bioRxiv - Physiology 2022Quote: ... pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Cancer Biology 2019Quote: Two independent shRNA vectors targeting RB1 were obtained from Addgene (Addgene ID: 25640 and 25641). Lentivirus was produced using standard virus production methods by co-transfecting target and packaging plasmids into HEK293T cells ...
-
bioRxiv - Developmental Biology 2021Quote: ... These two sites were cloned into the plasmid pCFD4-U6:1_U6:3tandemgRNAs (Addgene plasmid #49411). The plasmid was injected into y2cho2v1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... guides for candidate genes or two non-targeting guides were cloned into lentiCRISPR_v2 (Addgene #52961). Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were transfected with transfer plasmid and two helper plasmids psPAX2 (Addgene plasmid #12260) and VSV-G envelope expressing plasmid (pMD2.G ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplicons containing spacer sequences for two sgRNAs were generated from plasmid pCFD6 (Addgene 73915) using primers sgRNAampfwd ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The mouse Spdef cDNA and human SPDEF cDNA were synthetized from IDT and cloned into LentiV P2A Blast (Addgene_111887) using Gibson assembly (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Genetics 2021Quote: ... the pooled gRNA Brie library (Addgene #73632) was expanded in HEK 293T according to BSL2 guidelines ...
-
bioRxiv - Cancer Biology 2019Quote: Genome-wide libraries of sgRNAs from Addgene (hCRISPRi_v2 ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Brie library in LentiCRISPR_v2 (Addgene 73632) was obtained as a plasmid library and amplified in Stbl4 (Thermo ...
-
bioRxiv - Cancer Biology 2021Quote: The GeCKO pooled library (#1000000048, Addgene, USA) was amplified as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... plasmids containg the gRNA library (Addgene, 1000000048) were transfected into the HEK 293T cells together with the lentiviral packing vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... the Brie library in LentiCRISPR_v2 (Addgene 73632) was obtained as a plasmid library and amplified in Stbl4 (Thermo ...
-
bioRxiv - Cell Biology 2023Quote: Brunello library was purchased from Addgene (#73178). Library (50ng ...
-
bioRxiv - Synthetic Biology 2023Quote: ... TRE-MPRA libraries are available from Addgene under deposit number 82594.
-
bioRxiv - Genetics 2024Quote: ... and the pMCB320-ACOC library (Addgene #101926,37) bearing a mCherry reporter were obtained as gifts from Michael Bassik ...
-
bioRxiv - Molecular Biology 2024Quote: The lentiviral TKOv3 sgRNA library (Addgene #90294) was used to perform pooled genome-wide CRISPR knockout screens ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ren-Jang Lin (Addgene Pooled Library #112200) and selected for stable integration with 5 μg/mL blasticidin ...
-
bioRxiv - Cell Biology 2020Quote: ... The HA-GLUT4-mEos3.2 cDNA construct was generated by replacing GFP in the HA-GLUT4-GFP cDNA construct for mEos3.2 (Addgene plasmid #54525) (43 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Actin promoter and EGFP cDNA were replaced respectively with the TRE3G promoter and rtTA cDNA from inducible Caspex expression plasmid (Addgene). PCR was performed using PrimeSTAR MAX (TAKARA ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...
-
bioRxiv - Cell Biology 2021Quote: ... Wild-type Cdc42 cDNA was obtained from Addgene and subcloned into pRK5 with a Myc tag at the N-terminus ...
-
bioRxiv - Genetics 2021Quote: ... Jun and Egr2 cDNAs were derived from Addgene plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: EIF2A cDNA was cloned from pDONR223_EIF2A_WT (Addgene, 82111). EIF2A-TEV-GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... Resulting fragments and mCherry cDNA amplified from Addgene plasmid #102245 were assembled using Gibson Assembly ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA constructs were designed and obtained from Addgene, scaled in house using DH5α transformation competent cells (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNAs were cloned into pLenti (Addgene #22255) or pMSCV (Clontech) ...
-
bioRxiv - Genomics 2019Quote: ... two different sequences targeting Denr were cloned into pLKO.1puro backbone vector (Addgene no. 10878 (11)) ...
-
bioRxiv - Neuroscience 2020Quote: ... These two gRNAs were then subcloned into pSpCas9n(BB)-2A-GFP plasmid (pX461; Addgene No: 48140). We made use of Cas9 nickase (Cas9n ...
-
bioRxiv - Cell Biology 2021Quote: ... The two gRNAs were cloned into the backbone of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230), and transfected into MEF cells together with EGFP via lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: The following two Piezo sgRNAs and a control sgRNA were cloned into the lentiCRISPRv2 vector (Addgene) containing Cas9 ...
-
bioRxiv - Neuroscience 2020Quote: ... Two guides RNAs were selected and produced by PCR using the pX330 plasmid (Addgene, Watertown, MA) as a template ...
-
bioRxiv - Microbiology 2021Quote: ... two constructs (Fig. 1A) were made using a modified pgRNA-bacteria plasmid (NEB, Addgene plasmid # 44251). This plasmid ...
-
Improving the efficacy and accessibility of intracranial viral vector delivery in non-human primatesbioRxiv - Neuroscience 2022Quote: ... Subjects MTL1-3 were infused with two retrograde viruses (gifted from Edward Boyden & Karel Svoboda; Addgene viral preps #59170-AAVrg & #29017-AAVrg ...