Labshake search
Citations for Addgene :
351 - 400 of 985 citations for Two Hybrid cDNA Library since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Cells were co-transfected with two gRNAs and pSpCas9n(BB)-2A-Puro (PX462) V2.0 (Addgene, 62987 (Ran et al., 2013)) ...
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two gRNAs targeting Exon 1 (targeting sequence GGGCGCGCTACCTGTCTCCG) and Exon 10 (targeting sequence GAACTGGACTTTGAAAGAGG) were cloned in BPK1520 (Addgene #65777) and transfected with Amaxa Nucleofector II together with BPK4410 ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Biochemistry 2024Quote: ... expressing Cas9 nuclease and two gRNAs (see below for sequences) together with the CRIS-PITCh vector pX330S-2-PITCh (63670, Addgene), harboring the Lamin A microhomologies and GFP-Puro or GFP-Neo/Kan insertions ...
-
bioRxiv - Cell Biology 2024Quote: ... The PASSst sensor was created by fusion of two copies of PABD with the GCN4 that was amplified from pcDNA4TO-24xGCN4_v4-kif18b (#74934, Addgene, USA). The GCN4 probe was pHR-scFv-GCN4-sfGFP-GB1-dWPRE (#60907 ...
-
bioRxiv - Genetics 2024Quote: ... The two complementary DNA oligos of each sgRNA target were annealed and ligated to the pUC57-sgRNA plasmid (Addgene, USA) for cloning ...
-
bioRxiv - Cell Biology 2020Quote: ... The Toronto human knockout pooled library (TKO) Version 1 (Addgene #1000000069) was a gift from Jason Moffat19.
-
bioRxiv - Cancer Biology 2022Quote: ... lentivirus was produced from the Brunello sgRNA library (12) (Addgene 73178) in 293FT cells (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: Human CRISPR knockout pooled library (Brunello) was obtained from Addgene (#73178). Human CRISPRi pooled library (Dolcetto ...
-
bioRxiv - Cell Biology 2021Quote: The human GeCKO v2 library (2 plasmid system) (Addgene plasmid #1000000049) was amplified by electroporation using a Bio-Rad Gene Pulser II electroporation apparatus (Bio-Rad #165-2105 ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Biochemistry 2022Quote: The human CRISPR knockout pooled library Brunello was obtained from Addgene (a gift from David Root and John Doench ...
-
bioRxiv - Cell Biology 2020Quote: 100 ng of human sgRNA library Brunello in lentiCRISPRv2 (Addgene, #73179) was transformed into electrocompetent Endura cells (#60242 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... we bulk transferred sgRNA sequences from the lentiviral library (Addgene: #1000000096) into a pBabe-SV40-puro backbone ...
-
bioRxiv - Genomics 2019Quote: ... Sequence-verified oligo libraries were first cloned into pMPRA1 vector (Addgene) using SfiI site by electroporation into 10 times higher number of bacterial cells than the number of unique sequences in the oligo library ...
-
bioRxiv - Genetics 2020Quote: ... The chosen guides were cloned into pGL1-library vector (Addgene 84832). All guides used are listed in Supplementary Table 2.
-
bioRxiv - Immunology 2020Quote: GeCKO and Brunello whole-genome human libraries were acquired from Addgene. Smaller scale validation library was created by selecting the top 300 positive and 50 negative regulators from the Brunello screen and filtering for expression in Ramos cells ...
-
bioRxiv - Cell Biology 2022Quote: Dolcetto library (Sanson et al., 2018) was acquired from Addgene (#1000000114) as two plasmid pools ...
-
bioRxiv - Microbiology 2023Quote: ... and Human Interferon-Stimulated Gene CRISPR Knockout pooled Library (#125753, Addgene) (OhAinle et al. ...
-
bioRxiv - Pathology 2023Quote: ... The library was a gift from Feng Zhang lab (Addgene # 1000000049)58 ...
-
bioRxiv - Genomics 2023Quote: ... The amplified libraries were cloned into the CROPseq vector (Addgene #86708) via Golden Gate assembly using BsmBI restriction sites as previously described15 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The oligonucleotide library was assembled into pMPRAv3:Δluc:ΔxbaI (Addgene plasmid #109035) and expanded by electroporation into E.coli ...
-
bioRxiv - Genomics 2023Quote: ... 47,792 sgRNAs were selected from the Brunello CRISPR library (Addgene #73179), 20,520 sgRNAs were selected from the TKO V3 CRISPR library (Addgene #90294) ...
-
bioRxiv - Plant Biology 2023Quote: All libraries used in this study were constructed using pPSup (Addgene no ...
-
bioRxiv - Molecular Biology 2023Quote: The Mouse Improved Genome-wide Knockout CRISPR Library v2 (Addgene #67988) collection sgRNAs in lentiviral vectors targeting 18 ...
-
bioRxiv - Microbiology 2023Quote: ... The bovine libraries were cloned into lentiGuide-Puro plasmid (Addgene, #52963) and viruses were produced in HEK293FT cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... with the Brunello knockout pooled lentiviral library from Addgene (# 73179-LV) and in RPMI-1640 decomplemented medium (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral particles of the genome-wide gRNA library Brie (Addgene #73633) were generated according to standard protocols (Doench et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... and all sgRNAs from an existing genome-wide library (Addgene # 1000000100) targeting each gene in the subset were included in the validation library (10 sgRNAs for most genes) ...
-
bioRxiv - Microbiology 2024Quote: Libraries were cloned into a CROP-seq-puro-v2 (Addgene #127458) backbone and lentivirus was then produced and transduced as previously described (Feldman et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two pCFD4d plasmids (each at 40ng/µl) expressing four different sgRNAs were co-injected with 100ng/µl Hsp70-Cas9 (Addgene 45945) (Gratz et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... For the generation of the double K73E K80E (2KE) sov mutant two guides (Supplementary Table 3) were cloned into pDCC6 (Addgene 59985) and co-injected with an AltR HDR donor oligo (IDT ...
-
bioRxiv - Genetics 2019Quote: ... At least two genetically distinct sequences per candidate were then cloned into the firefly luciferase reporter plasmid pGL-Gateway-DSCP (AddGene 71506) using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Two complementary oligonucleotides were annealed and inserted into the BstX1 and Blp1 sites of the linearized pCRISPRia-v2 vector (Addgene, 84832) using T4 DNA ligase ...
-
bioRxiv - Biochemistry 2019Quote: ... The MIT-linker-BECN1 construct was then generated by amplifying residues 1-159 of NRBF2 including S113A and S120A with an overlapping linker sequence and performing two-step polymerase chain reaction with BECN1 and moved into vector 6A obtained from UC Berkeley macrolab (Addgene # 30124). Cells were lysed by gentle shaking in lysis buffer (50 mM HEPES ...
-
bioRxiv - Immunology 2019Quote: ... were incorporated into two complementary 100-mer oligonucleotides and cloned into a gRNA containing plasmid containing the (NeoR/KanR) cassette (Addgene # 41824). The human codon optimized pCAGGS-Cas9-mCherry was used for gene-editing experiments (a gift from Stem Cell Core Facility at Columbia University) ...
-
bioRxiv - Genomics 2021Quote: ... two guide RNA sequences (gRNA 5’ TTGGGGGGGCTACTGCCAGC 3’ and 5’ CTTGAACGCCACCCTCTAAC 3’) were cloned into pspCas9(BB)-2A-GFP (Addgene; #48138) and pspCas9(BB)-2A-RFP (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... trkB.DN-mCherry was inserted between the two double floxed sites in the pAAV-EF1a-DIO plasmid backbone (Addgene plasmid n°20949), using NheI and AscI as restriction enzyme cloning sites ...
-
bioRxiv - Neuroscience 2021Quote: ... was injected bilaterally into the pPVN and allowed to express for two to three weeks before 200 nL of AAV5-CAG-FLEX-ArchT-tdTomato (Addgene, 28305) (or pAAV2-hSyn-DIO-mCherry (Addgene ...
-
bioRxiv - Immunology 2021Quote: ... produced in HEK293FT cells transiently transfected with two packaging plasmids (psPAX2 and pMD2-G) and the lentiCRISPR v2 plasmid (Addgene #52961)11 containing a non-targeting (GGCATCTTAACTAATCGTCT ...
-
bioRxiv - Developmental Biology 2021Quote: gRNA Validation: Two CRISPR/Cas9 guide RNAs targeting the first exon of the SOX17 gene were cloned into pX458 (Addgene 48138) and validated in HEK293T cells (ATCC CRL-3216 ...
-
bioRxiv - Plant Biology 2023Quote: ... The final construct was assembled by combining the two Level 1 sgRNA cassettes with cassettes for resistance to kanamycin pICSL11024 (Addgene#51144) and constitutive expression of SpCas9 (pEPQD1CB0001 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... 293T cells were transiently co-transfected with the expression vector carrying either the GFP (pLVDest-GFP) or the GFP-MCIDAS gene (pLVDest-GFP-McIdas) and the two helper plasmids psPAX2 (packaging vector, Addgene 12260) and pMD2.G (envelope vector ...
-
bioRxiv - Neuroscience 2023Quote: Clonal hiPSCs from two donors of European ancestry (#690 (XY) and #2607 (XY)) with lenti-EF1a-dCas9-VPR-Puro (Addgene #99373), pLV-TetO-hNGN2-eGFP-Neo ...
-
bioRxiv - Cell Biology 2022Quote: ... plasmid pNH33 was generated by connecting two genes with a SL2 trans-splicing sequence and inserted into pCFJ910 (a gift from Erik Jorgensen, Addgene #44481) with the pie-1p and pie-1 3’UTR ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were grown to near confluency in a 10 cm dish and transfected with plx304-mCherry-SEpHluorin (Gift of Yi Liu and Diane Barber at UCSF) and two packaging plasmids: psPAX2 (Addgene #12260) and pmd2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2023Quote: Two sets of gRNAs targeting either exon 3 or exon3-7 of IL1R1 coding region were cloned in PX459 (Addgene 62988) and co-transfected in HT1080 cells ...
-
bioRxiv - Neuroscience 2024Quote: pAAV CAG-FLEx-FLPo was constructed by in-fusion-based PCR cloning utilizing the following two DNA fragments: i) SalI-AscI restriction fragment of pAAV CAG-FLEx-TCb (Addgene #48332) as a vector backbone ...