Labshake search
Citations for Addgene :
101 - 150 of 301 citations for PEG NH2 modified upconverting red light since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... The backbone plasmid was modified from plasmid CROPseq-Guide-Puro (Addgene, 86708), with an addition of a CMV promotor and removal of the gRNA scaffold ...
-
bioRxiv - Molecular Biology 2023Quote: ... we modified a lentiviral plasmid (pLenti CMVie-IRES-BlastR, Addgene accession: #11963) by replacing the blasticidin resistance cassette ...
-
bioRxiv - Molecular Biology 2024Quote: ... The gRNA screening vector was a modified CROP-seq vector (Addgene, #86708) to also express an EGFP and include a capture sequence in the scaffold of the gRNA62 ...
-
bioRxiv - Bioengineering 2024Quote: ... The knock-in construct was modified from pR26CAG/GFP Dest (#74286, Addgene) by VectorBuilder to include a bicistronic fluorescent reporter encoding both mRFP and eGFP ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral plasmids were generated based on a modified Puro-Cre vector (Addgene plasmid # 17408 ...
-
bioRxiv - Neuroscience 2021Quote: Tetanus toxin light chain (TeTxLC) was amplified by PCR from pGEMTEZ-TeTxLC (Addgene #32640, (Yu et al., 2004)) using forward primer ...
-
bioRxiv - Bioengineering 2024Quote: ... pcDNA3.1-Tras heavy chain-SpyTag003 (‘Tras NoLink’) and pcDNA3.1-Tras light chain (GenBank and Addgene deposition in progress) were cloned previously by Jamie Lam (University of Oxford ...
-
bioRxiv - Immunology 2023Quote: ... Amplicon from the first PCR reaction were used as templates for cloning into antibody expression vectors (Abvec2.0-IGHG1 for the heavy chain and Abvec1.1-IGKC or Abvec1.1.-IGLC2-XhoI for of the light chains, all from AddGene).
-
bioRxiv - Neuroscience 2021Quote: ... was injected in the right parvocellular red nucleus and retrogradeAAV-hSyn.Cre.WPRE.hGH (Addgene #105553) was injected in the lateral sector of the left facial nucleus ...
-
bioRxiv - Cell Biology 2020Quote: ... the lenti dCAS-KRAB_Blast vector was modified from lenti dCAS-VP64_Blast vector (Addgene) as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were then nucleofected with a modified version of the PX462 plasmid (AddGene) and selected for resistance to puromycin ...
-
bioRxiv - Bioengineering 2021Quote: ... CAR genes were cloned into a modified pHR_SFFV lentiviral transgene expression vector (Addgene plasmid #79121 ...
-
bioRxiv - Molecular Biology 2020Quote: ... we modified pU6-sgRNAEF1Alpha-puroT2A-BFP (gift from Dr. Jonathan Weissmen, Addgene: 60955) by replacing the puromycin gene with Hygromycin gene and made pU6-sgRNAEF1Alpha-HygT2A-BFP ...
-
bioRxiv - Biophysics 2020Quote: ... The SERCA2a cDNA was cloned into the mCerluean-M1 modified plasmid (Addgene, USA), yielding SERCA2a fused to a modified Cerulean fluorescent protein (mCer ...
-
bioRxiv - Genomics 2020Quote: ... gRNA sequences were cloned into a modified version of lentiGuide-Puro (Addgene#52963) in which the selection cassette had been swapped for Zeocin resistance ...
-
bioRxiv - Cancer Biology 2022Quote: ... were performed using a modified version of the lentiCRISPR v2 backbone (Addgene #52961), in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Cell Biology 2022Quote: ... A Dox-inducible Cas9 lentiviral vector was modified from LT3GEPIR (Addgene plasmid 111177): T3G-GFP-(miR-E)-PGK-Puro-IRES-rtTA3 ...
-
bioRxiv - Genomics 2023Quote: ... Amplified oligo pools were cloned into a modified CROPseq-puro-v2 (Addgene #127458) vector that removed the original scaffold sequence (referred as CRISPRmap-CROPseq ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli DH10B-ALT (E. coli DH10B modified to constitutively express araC, Addgene, #61151) and are listed in Table S1 ...
-
bioRxiv - Genetics 2024Quote: ... a modified version of PLGR002 which contains a second guide cassette (Addgene, 188320). Both guides within a vector were designed to target either ...
-
bioRxiv - Molecular Biology 2024Quote: ... The TP53 library was expressed in a modified lentiviral pMT_BRD025 vector (AddGene #113569)76.
-
bioRxiv - Developmental Biology 2024Quote: ... and modified rtTA (Tet_On 3G) under control of the UbC promoter (Addgene#19780). Transfections were performed in 6-well plates overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... and modified versions of the hygromycin-resistant and miniMos-enabled vector pCFJ1662 (Addgene #51482 ...
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Neuroscience 2021Quote: The cDNA encoding for mouse neurofilament light chain (NFL) was amplified from the vector pmNFL (a gift from Anthony Brown, Addgene plasmid #83127 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cas9 plasmid (pSpCas9(BB)-2A-BFP (a modified version of PX458 (Addgene plasmid # 48138), in which eGFP is replaced for tagBFP) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable integrants were then further infected by modified lentiGuide-puro plasmid (Addgene plasmid # 52963) whose original puro selection marker is replaced with ZSGreen1 which is amplified from pLVX-EF1a-IRES-zsGreen1 (Clontech ...
-
bioRxiv - Molecular Biology 2021Quote: ... EF1a promoter driven hSpCas9 with a hygromycin resistance marker (modified version of Addgene #52961) was stably integrated via lentiviral transduction into the previously described TetR-CBX7 reporter mESC cell line ...
-
bioRxiv - Systems Biology 2021Quote: Akt KTR was modified from the transposase transfection system PSBbi-FoxO1_1R_10A_3D vector (Addgene # 106278)48 for lentiviral production (Fig ...
-
bioRxiv - Cancer Biology 2022Quote: Individual gRNAs were cloned into the modified CROP-seq-MS2 or the pXPR_502 (Addgene #96923 was a gift from John Doench and David Root ...
-
bioRxiv - Cell Biology 2020Quote: ... the Arl13b mutant was subcloned into pmScarlet-I-N1 (modified from Addgene plasmid # 85044) or pmCherry-N1 (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... fly Actin>GFP1-10 was cloned into a modified version of pCFD3 (Addgene 49410) and injected into fly embryos (BestGene ...
-
bioRxiv - Biochemistry 2022Quote: Human PARP6 (Uniprot #Q2NL67-1) was cloned into a modified pFASTBac1 vector (Addgene #30116) with N-terminal 6X His-maltose binding protein (MBP ...
-
bioRxiv - Cell Biology 2023Quote: ... using Grant lab-modified versions of MiniMos enabled vectors pCFJ1662 (Hygromycin resistant; Addgene #51482) and pCFJ910 (G418 resistant ...
-
bioRxiv - Microbiology 2023Quote: ... genes were cloned into a modified pBAD vector (UCB Macrolab vector 8B, Addgene #37502). Mutants were made by PCR mutagenesis ...
-
bioRxiv - Cell Biology 2023Quote: ... CRISPR knockouts were performed by transfection with a modified version of px330 (Addgene #42230) which encodes Sniper Cas956 and EBFP2 joined by a P2A site in place of px330’s original Cas9 ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid dCas9-KRAB-MeCP2-GFP is modified from lenti_dCas9-KRAB-MeCP2 (Addgene #122205) by replacing the BSD with GFP ...
-
bioRxiv - Cell Biology 2024Quote: ... and the other gRNA was cloned into the px330-mCherry plasmid (modified from Addgene; Cat #98750 to incorporate mCherry reporter) ...
-
bioRxiv - Neuroscience 2024Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Bioengineering 2024Quote: The pLV-CMV-LoxP-DsRed-LoxP-eGFP plasmid used to produce virus (termed Traffic Light virus) was purchased from Addgene (#65726). HEK-293T cells were seeded into T175 flask at the density of 20 million/ flask ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with pEGFP-LC3 (EGFP-LC3: microtubule associated protein 1 light chain 3 fused with enhanced green fluorescent protein) (Addgene, 24920) at 0.1 µg of the plasmid (in 50 µl Opti-MEM® Reduced Serum Media ...
-
bioRxiv - Genomics 2020Quote: ... The backbone was modified from lentiCRISPR v259 (a gift from Feng Zhang, Addgene plasmid #52961) and the TIR1-9myc fragment was amplified from pBabe TIR1-9myc33 (a gift from Don Cleveland ...
-
bioRxiv - Developmental Biology 2020Quote: ... which is a modified version of SpCas9-T2A-Puromycin/gRNA vector (px459;116, Addgene plasmid #62988) similar to that described above ...
-
bioRxiv - Bioengineering 2021Quote: ... the coding region of MBP was modified from a pET28-MBP-TEV plasmid vector (Addgene). cDNAs corresponding to either Grl3p or the maltose binding protein were then cloned into a pET21a(+ ...
-
bioRxiv - Neuroscience 2021Quote: ... a modified version of the plasmid pJFRC164-21XUAS-KDRT>-dSTOP-KDRT>-myr::RFP (Addgene #32141), in which the 21XUAS element was replaced with a 13XLexAop2 element ...
-
bioRxiv - Molecular Biology 2021Quote: ... was generated from a modified version of the pgk-ATG-frt plasmid (Addgene plasmid #20734), in which the region of pgk-ATG-frt comprised between the EcoRI site and the PciI site was substituted with the rabbit β-globin polyadenylation signal (RBG pA) ...
-
bioRxiv - Neuroscience 2020Quote: ... Modified TALE constructs were created using PCR fragments amplified from pAAV-CW3SL-EGFP (Addgene # 61463), a gift from Bong-Kiun Kaang (Choi et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... The sgRNA/Cas9 plasmid was modified from SpCas9-2A-Puro V2.0 plasmid (Addgene, Feng Zang).
-
bioRxiv - Genetics 2022Quote: ... a modified pU6-sgRNA EF1Alpha-puro-T2A-BFP (pLG1) sgRNA expression plasmid (Addgene #60955, (75)) where an AscI restriction site was added between the BstXI and the BlpI sites that enabled diagnostic digestion after ligation for verification of positive colonies ...
-
bioRxiv - Immunology 2023Quote: ... Platinum-E retroviral packaging cells were transfected transiently with modified pMIG retroviral plasmids (Addgene, #9044) or a second-generation anti-hCD19 CAR construct (MSCV-myc-CAR2A-Thy1.1 ...