Labshake search
Citations for Addgene :
1401 - 1450 of 1569 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... NKX2-1 and mouse Foxa2 CDS were amplified using NKX2-1 (Addgene, #119173) and mFoxa2 (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... was constructed by inserting the cDNA of mkate2-3xGly flanked by two 800 bp homology arms into the entry vector backbone pENTR1a (Addgene Plasmid #17398). The pENTR1a backbone vector was digested with EcoRl-HF and BamHl-HF (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... pLBR08 was generated via Gibson assembly of PCR-amplified LAMP1 cDNA (from mTagRFP-T-Lysosomes-20 acquired from Nikon Imaging Center at UCSF, Addgene plasmid #58022) and PCR-amplified XTEN80-mEGFP-3xHA immunoprecipitation tag with a linearized backbone generated from ClaI and BspDI (New England BioLabs cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... pBABE-CXCL12α and pBABE-CXCL12γ were constructed by inserting CXCL12α or CXCL12γ cDNA containing C-terminally C9-tagged (TETSQVAPA) sequences into pBABE-puro (Addgene plasmid # 1764). Lentiviral and retroviral particle production and transduction were performed as described before29.
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The fragment comprised between the SalI and AleI restriction sites was replaced with the Cre recombinase cDNA amplified from pCAG-Cre (a gift from Dr Connie Cepko, Addgene plasmid # 13775)(Matsuda and Cepko ...
-
bioRxiv - Cell Biology 2021Quote: HEK-293T cells plated on polylysine-coated coverslips were transfected with cDNA (100 ng/40000 cells) coding for mitochondrial-targeted mCherry (mCherry-Mito-7, a gift from Michael Davidson (Addgene plasmid # 55102), (Olenych et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... and amplified ZBP1 cDNA using forward: GGGAATTCATGGCCCAGGCTCCTGCT and reverse: TAGCGGCCGCCTAAATCCCACCTCCCCA primers from pEGFPN.1 vector cloned into LeGO-iG2-IRES-EGFP vector (Addgene plasmid #27341) between EcoRI and NotI sites followed by 5x strep-tag II (TGGAGCCATCCGCAGTTTGAAAAA ...
-
Sunday driver mediates multi-compartment Golgi outposts defects induced by amyloid precursor proteinbioRxiv - Neuroscience 2021Quote: ... and EGFP cDNA were amplified by PCR and transferred into the vector pJFRC2-10×UAS-IVS-mCD8-GFP (plasmid #: 26214, Addgene, Cambridge, MA). The construct was then injected into embryos of PBac{y[+]-attP-3B}VK00033 to generate transgenic flies ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLenti-CMV-AktE17K-Hygro was generated by replacing GFP in pLenti-CMV-GFP-Hygro with AKTE17K cDNA from pFBD-Akt1(E17K) (Addgene plasmid #86563). pLenti-CMV-Fosl1-Hygro was generated by replacing GFP in pLenti-CMV-GFP-Hygro with Fosl1 cDNA from mouse embryonic fibroblasts (MEF) ...
-
bioRxiv - Immunology 2022Quote: ... The cDNA of FLAG-SLC29A3 was substituted with the BFP2Apuro sequence in the lentiviral pKLV-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene plasmid 50946), excluding the U6gRNA(BbsI ...
-
bioRxiv - Biophysics 2024Quote: The expression plasmid for HIS-tagged AavLEA1 was obtained from the Addgene plasmid repository [pET15b-AavLEA1 was a gift from Claude Férec (Addgene plasmid # 53093)]52 The expression plasmid for HIS-tagged RvLEAMshort was made by inserting a truncated cDNA from pEThT-RvLEAM49 [pEThT-RvLEAM was a gift from Takekazu Kunieda (Addgene plasmid # 90033)] ...
-
bioRxiv - Cell Biology 2022Quote: The TFAM-BioID2 fusion plasmid (lenti-CMV-TFAM-BioID2-IRES-Puro) was cloned by first inserting TFAM cDNA into the backbone of MCS-BioID2-HA4 (Addgene Plasmid #74224) with the addition of a short linker (2xGGGGS ...
-
bioRxiv - Biochemistry 2022Quote: ... To produce recombinant CK2 kinase the CKA2 gene was PCR amplified from yeast cDNA library and cloned into a pOPINF vector (a kind gift from Ray Owens, Addgene plasmid 26042) to encode a 3C-cleavable His6 fusion protein ...
-
bioRxiv - Cell Biology 2022Quote: ... To produce EGFP-APEX2-ARHGAP29 the ARHGAP29 cDNA was sub-cloned into the C1-A2E vector (65) by PCR using HA-ARHGAP29 (Addgene plasmid #104154) as a template ...
-
bioRxiv - Developmental Biology 2023Quote: Gene fragments were amplified from cDNA using oligonucleotide primers listed in Table S3 and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536) (Collins et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... or the double floxed control vector carrying a cDNA for mCherry alone (pAAV5-hSyn-DIO-mCherry, abbreviated here as Ctrl or control vector, #50459-AAV5, Addgene, Watertown, MA), using 0.3 μL of virus per site at a titer of > 1–2 x 10¹3 vg/mL ...
-
bioRxiv - Evolutionary Biology 2024Quote: Gene fragments for preparing dsRNA were amplified from cDNA using oligonucleotide primers listed in Table S2 and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536), followed by in vitro transcription as previously described55 ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression plasmids for WT and catalytic mutant mouse Lipin-1 were obtained from Addgene. Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: The truncated mouse Fzd2 gene (Fzd2-delN) was cloned from pRK5-mFzd2 (#42254, Addgene) with a 1D4 tag at the C terminus by PCR using the following primers ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP and gRNAs against mouse Ampkα1 (79004) and Ampkα2 (79005) were obtained from Addgene. C2C12 cells were first transfected with Ampkα1 gRNA and sorted with GFP ...
-
bioRxiv - Genetics 2022Quote: ... mouse cGAS was amplified via PCR from a pMSCVpuro-eGFP-cGAS template (Addgene, 108675) using primers containing KpnI and NotI restriction sites (S1 Table) ...
-
bioRxiv - Cell Biology 2020Quote: Mouse GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene # 1000000052). To prepare lentivirus particles ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527; http://n2t.net/addgene:45527; RRID:Addgene_45527) were gifts from Haining Zhong 73 ...
-
bioRxiv - Cell Biology 2024Quote: ... kit using 3 µg of mouse Septin 12-GFP plasmid (pEGFP-C1, Addgene, USA) and 3 µg of mouse Lamin B1 or Lamin B2 or Lamin B3 plasmids conjugated with myc-tag (pCS2-MT ...
-
bioRxiv - Cancer Biology 2024Quote: ... NAMPT and mouse Fn14 CRISPR KD cells were generated using lentiCRISPR v2 (Addgene; 52961) cloned with two different sgRNA guides.
-
bioRxiv - Biochemistry 2021Quote: The RAS binding domain of C-RAF kinase (RAF-RBD) (Brtva et al., 1995) and full-length human RASSF5 from the RAS clone collection were obtained from Addgene (Raf1-RBD: #13338, RASSF5: #70545). The RAS clone collection was a gift from Dominic Esposito (Addgene kit 1000000070) ...
-
bioRxiv - Biophysics 2024Quote: ... the DNA fragments of human TDP-43 obtained from the TDP-43 expression plasmid as previously reported 45 and G3BP1 from Addgene (Clone#129339, Watertown, MA, USA) were inserted into the HindIII and BamHI sites of pcDNA-SNR (pTDP43-SNR and pG3BP1-SNR ...
-
bioRxiv - Cell Biology 2022Quote: 6.0 × 10^6 BJAB clone B2 cells expressing both Cas9 and ERAAP dsRed were transduced with lentivirus of human GeCKO v2 library (Addgene, #1000000049, gift from Feng Zhang) at an MOI of 0.4 using spin-infection (1,000 g for 2 h at 33 °C) ...
-
bioRxiv - Cancer Biology 2024Quote: ... We checked Cas9 expression by Western-Blot and selected the clone with the most efficient Cas9 nuclease activity using a Cas9 activity reporter (Addgene, ref. 67983 and ref. 67984). The Cas9-expressing U251 clone was expanded ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNAs of miRFP670 and miRFP703 were obtained from pmiRFP670-N1 and pmiRFP703-N1 (gifts from Vladislav Verkusha, Addgene plasmids #79987 and #79988), and subcloned to obtain pMNATZA1-miRFP670 and pMNATZA1-miRFP703 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNAs were used as PCR templates for cloning into modified pFastBac vectors (derivatives of 438-A and 438-C; Addgene 55218 and 55220) by ligation independent cloning (LIC)37 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse PGC-1α FL and ΔCTD were PCR-amplified from the pcDNA-f:PGC1 (Addgene, # 1026) and pcDNA-f:PGC1(delta CTD ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid for inserting transgene into mouse genome: pBT378_pattB-pCA-GFP-pA-attB plasmid (Addgene, 52554).
-
bioRxiv - Cancer Biology 2023Quote: ... GSDME-EGFP or mouse Mlh1 lentiviral vector and packaging plasmids pCMV-VSV-G (Addgene #8454) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2024Quote: ... targeting mouse Pvrl2 or Pvr were cloned into pSpCas9(BB)-2A-GFP plasmid (PX458, ADDGENE). 6 μg of each vector was transfected into tumor cells plated on a 6-well plate using FuGENE6 transfection reagent (Promega ...
-
bioRxiv - Microbiology 2020Quote: Lentivirus was produced in HEK293FT by co-transfection of cDNA containing lentiviral plasmid together with pCMV-dR8.2 dvpr (Addgene, #8455, gift from Bob Weinberg), pCMV-VSV-G (Addgene ...
-
GRASP55 Safeguards Proper Lysosome Function by Controlling Sorting of Lysosomal Enzymes at the GolgibioRxiv - Cell Biology 2024Quote: ... from WI-26 cDNA and cloning of the cDNA into the AscI and XhoI restriction sites of the Str-KDEL_ManII-SBP-EGFP vector (Addgene plasmid #65252, described in 56). Next ...
-
bioRxiv - Molecular Biology 2020Quote: CRISPR–Cas9 screen was performed using genome-scale mouse Brie CRISPR knockout pooled library (Addgene #73633) 68 ...
-
bioRxiv - Immunology 2020Quote: ... we first amplified sgRNA sequences from an optimized mouse CRISPR knockout library lentiCRISPRv2-Brie (Addgene #73632). A total of eight 50 μL PCR reactions were performed to maximize coverage of sgRNA complexity ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mouse Improved Genome-wide Knockout CRISPR Library v2 was a gift from Kosuke Yusa (Addgene #67988) (Tzelepis et al ...
-
bioRxiv - Immunology 2021Quote: Full-length mouse and human NLRP3 were cloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863). The resulting constructs were further modified by addition of N-terminal FLAG-tag followed by fluorescent protein mScarlet and Tobacco Etch Virus (TEV ...
-
bioRxiv - Molecular Biology 2021Quote: Notch1 and Jagged1 constructs were generated by polymerase chain reaction (PCR) using mouse Notch1 (Addgene 41728), human Notch1 (kind gift of Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression vectors for mouse PDGFRα and PDGFRβ were generated from pcDNA5FRT-EF-Pdgfra-EGFPN (Addgene #66787) and pcDNA5FRT-EF-Pdgfrb-EGFPN (Addgene #66787) ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Immunology 2023Quote: ... mouse naïve CD4+ T cells were transfected with p8xEGFP-N1 (Addgene # 122168, gift from Georg Mayr) which expresses 8 concatemeric EGFP proteins ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HA-Sox9-P2A and P2A-Cre blocks were PCR-amplified from pWPXL-Sox9 (Addgene, #36979) and AAV:ITR-U6-sgRNA(backbone)-TBG-Cre-WPRE-hGHpA-ITR(Katsuda et al. ...
-
bioRxiv - Cell Biology 2023Quote: Mouse HA-Sox4-P2A and P2A-Cre blocks were PCR-amplified from pLVXT-Sox4 (Addgene, #101121) and AAV:ITR-U6-sgRNA(backbone)-TBG-Cre-WPRE-hGHpA-ITR31 respectively ...
-
bioRxiv - Microbiology 2024Quote: ... iBMDM cell suspensions were mixed with 2 µg of pEGFP VAMP2 (mouse; Addgene plasmid # 42308 (51). Cells were electroporated using the program FF-100 and immediately transferred to pre-warmed DMEM ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sensing domain for cAMP comprised residues of 199–358 of mouse Epac1 (Addgene plasmid #73938). The sensing domain for citrate comprised residues 4–133 of the CitAP domain from Klebsiella pneumoniae CitA protein (Addgene plasmid #134301) ...