Labshake search
Citations for Addgene :
1301 - 1350 of 1569 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... For the rescue experiment CTCF pLoF clones C13 and C21 were transfected with either pKS004-pCAGGS-3XFlag-CTCF-eGFP plasmid (a gift from Elphege Nora, Addgene plasmid #156438) [53] or GFP-NLS (a plasmid expressing GFP fused to a nuclear localization signal that was a gift from Michael Bustin ...
-
bioRxiv - Cell Biology 2023Quote: Stable MEL cell clones expressing dCAS9-KRAB were generated using Lenti-dCAS9-KRAB-blast (Gift from Dr. Gary Hon, Addgene plasmid #89567). 2 × 106 of MEL cells were suspended in 100ul of High-Performance Electroporation Solution (BTXpress ...
-
bioRxiv - Immunology 2023Quote: ... ICAM1 knockout was made by first cloning an ICAM1-targeting sgRNA into a modified lentiCRISPRv2 plasmid with an RFP reporter instead of puromycin (RFP subclone kindly provided by Prof. Ravindra Majeti; original clone was a gift from Feng Zhang, Addgene plasmid #52961). Third generation lentivirus was produced as described16 ...
-
Lysyl oxidase regulates epithelial differentiation and barrier integrity in eosinophilic esophagitisbioRxiv - Cell Biology 2023Quote: Lentiviral vectors pLX304-eGFP and pLX304-LOX were constructed by Gateway LR reaction of entry clones pENTR223-LOX (HsCD00378945, PlasmID Harvard Medical School) and pDONR221-eGFP (Addgene vector 25899) with destination vector pLX304 (Addgene vector 25890) ...
-
bioRxiv - Genetics 2020Quote: Mouse Arid1a gRNA (GCTGCTGCTGATACGAAGGTTGG) was cloned into LentiGuide-puro plasmid (Addgene #53963). LentiCas9-Blast plasmid was purchased from Addgene (Addgene #53962) ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse HA-Bnip3ΔExon3 (sNip) (Accession #MF156210) were described previously (Addgene #100793) [39] ...
-
bioRxiv - Cancer Biology 2021Quote: A promoter and enhancer element upstream of mouse Fabp4 (from Addgene #8858) was cloned into pAAV-iCre-WPRE (Vector Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... coding sequence of mouse Cry1 and firefly Luciferase in pG5luc plasmid (Addgene) was amplified with primers having EcoRV-NotI and NotI-XhoI flanking sites for Crys and Luc ...
-
bioRxiv - Cell Biology 2020Quote: ... we used a mouse pooled kinome CRISPR-Cas9 pooled library (#75316, Addgene) (23) ...
-
bioRxiv - Physiology 2024Quote: ... (1.3 × 1011 plaque-forming units per mouse, ((107787-AAV8, Addgene, Watertown, MA)) ...
-
bioRxiv - Developmental Biology 2023Quote: The mouse Runx1 overexpression plasmid pCDNA3.1-Flag-Runx1 was purchased from Addgene. The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene ...
-
bioRxiv - Cancer Biology 2022Quote: ... the mouse Snai1 gene was amplified from pTK-Snai1 plasmid (#36976, Addgene) using primers (forward ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding the scFv(H2)-Fc(mouse) is available from Addgene; #190691 ...
-
bioRxiv - Molecular Biology 2024Quote: ... untagged p300 and FLAG/HA-tagged mouse CBP were obtained from Addgene (Cat ...
-
bioRxiv - Biochemistry 2024Quote: ... pCMV5 mouse Src was a gift from Joan Brugge & Peter Howley (Addgene plasmid # 13663 ...
-
bioRxiv - Biochemistry 2024Quote: ... transduced with the sgRNA against mouse Rap1 cloned in LcV2-Hygro (Addgene plasmid # 91977 ...
-
bioRxiv - Molecular Biology 2020Quote: ... full-length Npac/Glyr1 cDNA was ligated into MluI and NotI restriction sites of pMXs plasmid (18656, Addgene. Watertown, MA). To construct Npac mutant plasmid that produces functional Npac protein but was resistant to Npac RNAi targeting ...
-
bioRxiv - Bioengineering 2020Quote: ... and mRuby2-tagged Lifeact were constructed by inserting the PCR-amplified cDNAs (human TAGLN2, pFN21ASDA0120, Kazusa DNA Research Institute; Lifeact, Addgene plasmid # 54688 ...
-
bioRxiv - Microbiology 2021Quote: ... A549 PAF1 and STAT2 rescue cells were created by cloning PAF1 and STAT2 cDNA into pLenti6 plasmid (Addgene #89766, 54). Lentiviral packaging was performed as described above ...
-
bioRxiv - Cancer Biology 2021Quote: Human H-RasG12V cDNA sequence was cloned into LeGO-iV2 and LeGO-iC2 bicistronic vectors (Addgene #27344 and #27345, respectively). Retroviruses were produced by JetPEI (Polypus-Transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... and non-targeted Suv420-GFP was achieved by cloning the respective cDNA into Addgene vector CENP-B DBD INCENP GFP (45237, Addgene) at NheI / BamH1 ...
-
bioRxiv - Microbiology 2020Quote: ... The fragment containing hACE2-V5 was digested by the XbaI and Sall restriction enzymes from the hACE2 cDNA and was cloned into pLenti-GFP (Addgene) in place of green fluorescent protein (GFP) ...
-
bioRxiv - Microbiology 2020Quote: An ACE2 lentivirus expression CS(ACE2)IB vector was constructed by inserting a cDNA encoding an unaltered ACE2 (Addgene:1786) or an catalytically inactive ACE2 mutant (ACE2-H374N&H378N ...
-
bioRxiv - Neuroscience 2021Quote: ... We then inserted NFIA and SOX9 cDNA joined by a T2A sequence into an AAVS1 safe-harbor plasmid containing a dox-inducible cassette (Addgene plasmid no ...
-
bioRxiv - Synthetic Biology 2020Quote: ... moonbody (S5.1) cDNA was amplified via PCR and then inserted into the pSH-EFIRES-P-AtAFB2-mCherry vector (Addgene, #129716) between EcoRI and NotI sites to replace mCherry.
-
bioRxiv - Developmental Biology 2020Quote: ... the coding sequence for ZSCAN4C was amplified from cDNA and subcloned into the plasmid PB-TRE-dCas9-VPR (63800, Addgene), after removing the dCas9-VPR insert ...
-
bioRxiv - Microbiology 2021Quote: ... we cloned the human ACE2 cDNA sequence (NP_001358344.1) into a pLV-EF1a-IRES-Puro backbone vector (Addgene, cat no. 85132), and prepared lentiviral particles as described previously65 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and its RdRp domain (aa 91-610) were obtained using PCR on a SINV cDNA plasmid template (pSIN ReP5-GFP-GluR1 from Addgene). The PCR fragments were subcloned into the pSUMO-LIC vector using a ligation-independent cloning method in which the expressed recombinant protein had an N-terminal hexahistidine-linked small ubiquitin-like modifier protein (His6-SUMO ...
-
bioRxiv - Microbiology 2021Quote: The lentiviral particles expressing individual cDNA labelled with an mCherry marker were generated by co-transfection of the cDNA plasmid mixture with two lentiviral packaging plasmids pR8.74 and pVSV-G (Addgene, 12259) as a proportion of 10:10:1 into HEK293T cells ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA for mutant APP harboring the Swedish and Indiana mutations was cloned into a pHIV-Zsgreen backbone obtained from Addgene. Lipofectamine 2000 was used to transduce the construct (either pHIV-Zsgreen+mutant APP or pHIV-Zsgreen alone ...
-
bioRxiv - Cancer Biology 2022Quote: The cDNA sequence encoding RARα LBD or RXRα LBD were cloned into pET His6 TEV LIC cloning vector (Addgene 29666), pET His6 MBP TEV LIC cloning vector (Addgene 29708 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the PRKRA CDS (amplified from a Mael-/- testis cDNA sample) and the P2A-EGFP-ori-AmpR fragment (from Addgene #112101).
-
bioRxiv - Neuroscience 2022Quote: ... the complementary DNA (cDNA) for each iMN factor (Ngn2, Lhx3, Isl1, NeuroD1, Ascl1, Brn2 and Myt1l) was purchased from Addgene and cloned into the pMXs retroviral expression vector using Gateway cloning technology (Invitrogen) ...
-
bioRxiv - Biochemistry 2023Quote: ... Sid4 cDNA was cloned into the pET His6 MBP PreScission LIC cloning vector (gift from Scott Gradia, Addgene plasmid #29721). His-MBP-Sid4 was purified on amylose beads in column buffer containing 300 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... the lentiviral vectors encoding each SLX4 cDNA (kindly provided by Dr. Minoru Takata) were individually co-transfected with two assistant vectors pMD2.G (#12259, Addgene) and psPAX2 (#12260 ...
-
bioRxiv - Cancer Biology 2023Quote: The lentiviral construct for the constitutive expression of the bioluminescence (firefly luciferase) and the red fluorescence (mCherry) was generated by amplifying the cDNA encoding both genes from Addgene Plasmid #44965 and cloned in the lentivirus backbone (Addgene #12262 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sense and antisense riboprobes were designed by subcloning fragments of coding cDNA sequences in pBlueScript II (SK or KS) plasmids (Addgene). Riboprobes were generated by in vitro transcription using the SP6/T7 DIG RNA labelling kit (Roche ...
-
bioRxiv - Genomics 2023Quote: ... The original CRISPRoff plasmid DNA (except the region encoding TagBFP) and mScarletI cDNA from the pmScarlet-i_C1 plasmid (Addgene # 85044) were amplified by polymerase chain reaction (PCR ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Plant Biology 2023Quote: The full-length or 3TPR-truncated cDNA sequence of SPY was amplified from Arabidopsis cDNA with appropriate primers (listed in Supplemental Table 1) and cloned into the pET28sumo vector (Addgene?), which adds a 6xHis-SUMO tag to the N-terminus of the protein of interest ...
-
bioRxiv - Cell Biology 2023Quote: ... amino acids 1220-1711) of 53BP1 from TP53BP1 cDNA (a gift from Anthony Davis) and cloned into a pBABE-zeo construct (Addgene). DLD-1 cells engineered to carry the dCas9-SunTag system and expressing H2B-mCherry were transduced with retroviruses that were packaged in 293GP cells for 24 hours and selected with 50 μg/mL zeocin for two weeks ...
-
bioRxiv - Neuroscience 2023Quote: A 2.2 kb BamHI-SalI cDNA fragment of the long form of human PREPL (PREPLL) was cloned into pLenti-GFP (Addgene) digested with the same restriction enzymes ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Genomics 2023Quote: ... The cDNAs for 3XHA-mCherry-OMP25 and 3XMyc-mCherry-OMP25 were cloned into pLV-EF1a-IRES-Blast backbone (Addgene, #85133) by using Gibson assembly ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Nexn coding sequence was PCR amplified from the cDNA of murine hearts and subcloned into pFLAG-MRTFA (Addgene #11978) to create the pFLAG-Nexn plasmid.
-
bioRxiv - Cell Biology 2024Quote: ... mCherry-FokI and the catalytically dead mCherry-FokI (D540A) cDNAs were subcloned into the mCherry-LacI vector (Addgene plasmid #18985) replacing mCherry ...
-
bioRxiv - Immunology 2022Quote: ... HHLA2 cDNA included 5’ EcoRI and 3’ NotI sites and was cloned into the pBMN-IRES-GFP vector (Addgene #1736). PCR (Q5 enzyme ...
-
bioRxiv - Cell Biology 2022Quote: For complementation experiments, CIP2A cDNA (a gift from Qing Zhang, UT Southwestern Medical Center, USA) and a HaloTag (Addgene 112852) were cloned into pBABE-zeo and packaged in 293GP cells by co-transfection with pVSV-G using X-tremeGENE 9 ...
-
bioRxiv - Molecular Biology 2023Quote: Stimulated emission depletion microscopy was performed on U2OS cells transduced with lentivirus expressing Flag-tagged PREPL cDNA (pCIG3, Addgene #78264). Cells were seeded 3 days post-transduction on coverslips (thickness #1.5H ...
-
bioRxiv - Immunology 2023Quote: ... Stable transfection was performed by transfecting T2 cells with 4.5ug of HLA cDNA in the pSBbi-GP backbone and 0.5ug of pCMV(CAT)T7-SB100[15] (Addgene plasmid # 34879), followed by puromycin selection.