Labshake search
Citations for Addgene :
1251 - 1300 of 1569 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Molecular Biology 2023Quote: The Mouse Improved Genome-wide Knockout CRISPR Library v2 (Addgene #67988) collection sgRNAs in lentiviral vectors targeting 18 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse SEPT6-GFP construct was purchased from Addgene (Addgene plasmid# 38296) and was cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... mouse SOX9 was amplified from plasmid tetO.Sox9.Puro [bought from Addgene, catalog number #117269] ...
-
bioRxiv - Synthetic Biology 2024Quote: Mouse WNT5A was amplified from plasmid pRK5-mWnt5a [bought from Addgene, catalog number #42279] ...
-
bioRxiv - Cell Biology 2024Quote: ... An entry vector containing mouse mfge8/LactC1C2 coding region (Addgene #52987) (MAPES et al ...
-
bioRxiv - Genetics 2021Quote: ... for the deletion step using a one-step cloning reaction as described by the Thomas lab 25 The same protocol with the minor modification of replacing the second oligo with water during ligation was used to clone the syn-sgRNAs into pX459 (Addgene #62988). A cloning mixture volume of 5μL or 10μL was then transformed into 25μL or 50μL ...
-
bioRxiv - Microbiology 2020Quote: ... the SLC35B2 clones have been generated into HCT116cas9 cells that are expressing mCherry and Citrine due to integration of miReporter-PGK (Addgene#82477).
-
bioRxiv - Cell Biology 2020Quote: HAP1 wt cells as well as single cell-derived clones were obtained from Haplogen Genomics or generated in-house by transient transfection with px459 (Addgene #48139) vectors carrying sgRNAs against the selected genes ...
-
bioRxiv - Cell Biology 2020Quote: ... was made by amplifying TPD54 by PCR from human Tumor protein D54 (IMAGE clone: 3446037) and inserting into pIRES-EGFP-puro (Addgene #45567) via NheI and XhoI ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 CRISPR/Cas9 edited cell lines were generated by first isolating clones with doxycycline-inducible expression of Cas9 (Addgene, 50661), then infected with lentivirus harboring the sgRNA and selected with 4 μg/ml blasticidin ...
-
bioRxiv - Plant Biology 2023Quote: ... an expression clone was generated by cloning the tdT coding sequence (amplified from an AddGene-derived plasmid (Shaner et al., 2004)) into the BglII cloning site of plasmid pLAU2 using Gibson assembly (Idnurm et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... Entry clones were assembled in an empty rBiFC destination vector (pBiFCt-2in1-CC, Addgene 105114 or pBiFCt-2in1-NC, Addgene 105112) with a Gateway LR recombination reaction and selected using LB containing spectinomycin and XgalI ...
-
bioRxiv - Cancer Biology 2024Quote: shRNAs targeting luciferase (shLuc) or murine Psat1 (shPsat1) (clone #640) were cloned into a doxycycline (doxy)-inducible EZ-tet-pLKO-Puro vector (Addgene #85966). Lentiviral particles were generated by transfecting 293T cells with 1.5 µg ps-PAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2024Quote: ... a NALM-6 clone bearing an integrated doxycycline-inducible Cas9 expression cassette generated by lentiviruses made from pCW-Cas9 (Addgene #50661) was transduced with the genome-wide KO EKO sgRNA library83 (278,754 different sgRNAs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and subcloned in the pBabe-puro GFP-N-term pCDNA-T0-FRT-Streptag (41) and pSBbi-PUR Sleeping Beauty-based expression vectors (Addgene #6023, a gift from E. Kowarz) (42) ...
-
bioRxiv - Developmental Biology 2020Quote: ... sgRNA sequences targeting the N-terminal region of the predicted small peptides were inserted into pSpCas9(BB)-2A-GFP (Addgene plasmid #48138, gift from Feng Zhang) via its BpiI cloning sites ...
-
bioRxiv - Cell Biology 2020Quote: ... and WD repeat domain phosphoinositide-interacting protein 1 (WIPI1) cDNA was a gift from Noboru Mizushima (Addgene plasmid # 38272) (Itakura & Mizushima ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids for expression of zinc finger fusion-proteins were newly generated based on the following cDNAs: pMT2 CaVβ1b GFP (gift from Annette Dolphin obtained through Addgene, plasmid # 89893 ...
-
bioRxiv - Cancer Biology 2020Quote: ... was used to transfer the ZEB1 cDNA from the pENTR1A-ZEB1 vector into the PB-TAC-ERP2 (#80478, Addgene) to generate the PB-ZEB1 vector ...
-
bioRxiv - Biochemistry 2020Quote: The cDNAs for protein expression in this study were as follows: DCLK1 (Transomic, BC133685) and Lambda phosphatase (Addgene, 79748). DCLK1 proteins were cloned in frame using Gibson cloning into a pET28 vector with an N-terminal strepII-Tag and a superfolder GFP (sfGFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... full-length human SETDB1 cDNA was cloned into the NotI sites of the pcDNA3.1(+)-IRES-GFP (Addgene; Cat#: 51406). For transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid expressing Dx-inducible MeCP2 was made by cloning the cDNA into FUW-TetO-MCS vector (Addgene plasmid #84008). Plasmid expressing MeCP2 and GFP tagging was made by cloning the cDNA into pLVX-EF1α-IRES-ZsGreen1 vector (TaKaRa plasmid #631982) ...
-
bioRxiv - Molecular Biology 2020Quote: The RAD51 overexpression plasmid (pAB1118) was constructed by cloning RAD51 cDNA into the pCAGGS-mCherry plasmid (Addgene, plasmid #41583). First ...
-
bioRxiv - Neuroscience 2020Quote: The epha4b cryptic transcript was amplified from cDNA and inserted into the multi-cloning site of plasmid pCS2+ (Addgene). The in-vitro transcription reaction was performed on linearized plasmid using the mMessage mMachine SP6 Transcription Kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2022Quote: The pmNFM plasmid containing cDNA encoding for NFM was a gift from Anthony Brown (Addgene plasmid #83126; http://n2t.net/addgene:83126; RRID: Addgene_83126)87.
-
Using optogenetics to link myosin patterns to contractile cell behaviors during convergent extensionbioRxiv - Developmental Biology 2021Quote: ... and the cDNA of CRY2PHR was PCR amplified from the pCRY2PHR-mCherryN1 plasmid from the Tucker Lab (Addgene 26866) (7) ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length and C-terminal truncated KDM6B cDNA was amplified by PCR from KDM6B plasmids (Addgene, #21212 and #21214) and subcloned into pLVX-Ubc-FLAG vector ...
-
bioRxiv - Immunology 2021Quote: ... A plasmid expressing SP140 was made by cloning the purified SP140 cDNA into the p3xFLAG-CMV-10 vector (Addgene) using Gateway techniques (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... The untagged CDK9 plasmid was obtained by cloning the cDNA of HA-CDK9 (gift from Andrew Rice, Addgene #28102) in pCDNA3.1 ...
-
bioRxiv - Genomics 2023Quote: ... according to the manufacturer’s instructions to remove the 78 bp mitochondrial localization signal (MLS) from RNase H1 cDNA (AddGene; pFRT-TODestGFP_RNAseH1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The vector was designed for simple cut and paste replacement of the TAD region downstream of the Gal4-DBD with alternative TADs which were PCR’d out of cDNA expression vectors obtained from Addgene. Primers used are listed in Data S5 ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviruses were generated after subcloning the PITPNA cDNA sequence into the expression vector pCCL-cPPT-PGK-IRES-WPRE (Addgene). The resulting construct was transfected along with packaging plasmids pMD2.G and pSPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... its shorter isoform has been amplified from IMR90 cDNA with specific primers and cloned in pcDNA3.1(+) vector (purchased from Addgene). For overexpression studies ...
-
bioRxiv - Developmental Biology 2023Quote: Full length fmi cDNA from UAS-fmi (ref 7) was subcloned in two EcoR1-Xho1fragments into pQUAST (#24349; Addgene) and transformed into w1118 flies to generate random genomic insertions.
-
bioRxiv - Cancer Biology 2022Quote: ... Histone H2A cDNA were PCR amplified from pCDNA3.1-Flag-H2A and pCDNA3.1-Flag-H2A K118-119R51 (Addgene, #63560, #63564). Histones Macro-H2A cDNAs were obtained for the DKFZ cDNA clone repository.
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid containing chTOG cDNA was a gift from Stephen Royle (Addgene plasmid # 69108; http://n2t.net/addgene:69108; RRID: Addgene_69108). The chTOG cDNA was subcloned into a modified pFastBac vector containing an N-terminal 6xHis tag (a gift from G ...
-
bioRxiv - Immunology 2024Quote: hPD-1 retroviral plasmid was generated by inserting hPD-1 cDNA into MSCV-IRES-Thy1.1 DEST (Addgene, catalog# 17442). Point mutations were introduced by using QuikChange ll site-directed mutagenesis kit (Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... isoform 1) was amplified from K562 cDNA and inserted into insect cell expression vector 438-B (Addgene plasmid: 55219) (N-terminal 6x His (His6 ...
-
bioRxiv - Cell Biology 2024Quote: ... the following cDNA sequences were cloned into pLKO.1 which was a gift from David Root (Addgene plasmid # 10878). by Genscript Corporation:
-
bioRxiv - Cancer Biology 2024Quote: ... The pCDH-CMV-MYC-ADAR1-Neo expression vector was generated by inserting the full-length ADAR cDNA (NM_001111) purchased from Addgene into the pCDH-CMV-MCS-EF1α-Neo vector obtained from Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... harboring the full-length cDNA of human wild type Androgen receptor (AR) (Addgene plasmid # 89078; http://n2t.net/addgene:89078; RRID: Addgene_89078) was procured from Addgene [17] ...
-
bioRxiv - Developmental Biology 2020Quote: ... DBD and AD sequences along with the Drosophila synthetic minimal core promoter (DSCP) region were amplified using PCR from vectors pBPZpGal4DBDUw and pBPp65ADZpUw (Addgene clone 26234) using primers that added NotI and AvrII restriction sites (CTGATCGCGGCCGCAAAGTGGTGATAAACGGCCGGC and GATCAGCCTAGGGTGGATCTAAACGAGTTTTTAAGCAAACTCAC) ...
-
bioRxiv - Cancer Biology 2020Quote: ... U-2OS-SEC (Stably Expressing inducible Cas9) clones were generated by lentiviral infection with TLCV2 vector (a kind gift from Adam Karpf, Addgene plasmid #87360) followed by puromycin selection (1µg/ml) ...
-
bioRxiv - Bioengineering 2021Quote: ... and Tspan12 were gifts from Jeremy Nathans and the human ACE2 clone (Shang et al., 2020) was obtained from Addgene (code 145033). Synthetic DNA fragments of engineered VH containing SARS-CoV-2 RBD (resi 333-527 ...
-
bioRxiv - Molecular Biology 2020Quote: ... EJ5-GFP HCT116 cells and EJ5-GFP U2OS reporter cells were similarly generated by selecting stable clones after electroporation of HCT116 and U2OS cells with XhoI linearized pimEJ5-GFP (25) (Addgene, plasmid 44026) DNA ...
-
bioRxiv - Developmental Biology 2023Quote: Riboprobes for in situ hybridization were synthesized using the oligonucleotide primers listed in Supplementary Table 4 to clone the DNA fragment of interest into vector pJC53.2 (Addgene Plasmid ID: 26536), followed by riboprobe synthesis previously described 80.